ID: 1036632607

View in Genome Browser
Species Human (GRCh38)
Location 8:10525858-10525880
Sequence GAGAGAAAGGACAAGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036632607_1036632610 -10 Left 1036632607 8:10525858-10525880 CCAAACCACTTGTCCTTTCTCTC 0: 1
1: 0
2: 3
3: 28
4: 406
Right 1036632610 8:10525871-10525893 CCTTTCTCTCCTCTCTCCCCTGG 0: 1
1: 0
2: 15
3: 125
4: 960
1036632607_1036632617 24 Left 1036632607 8:10525858-10525880 CCAAACCACTTGTCCTTTCTCTC 0: 1
1: 0
2: 3
3: 28
4: 406
Right 1036632617 8:10525905-10525927 ACTTGTCTAACCCTGAGTTTTGG 0: 1
1: 0
2: 0
3: 3
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036632607 Original CRISPR GAGAGAAAGGACAAGTGGTT TGG (reversed) Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
901425734 1:9181570-9181592 AAGGGAAAGGAAAAGTGCTTCGG - Intergenic
902648043 1:17817677-17817699 AAGAAAAAAGAAAAGTGGTTGGG - Intronic
904076882 1:27850037-27850059 GAGAGAGAAGACAAGAGGTGAGG - Intronic
904718785 1:32490507-32490529 GAGAAAAACGAAAAGTGTTTTGG + Exonic
905429492 1:37911093-37911115 AAGAGTAAGGTCAAGTTGTTTGG - Intronic
905646834 1:39630775-39630797 AAGAGGAAGAACAAGTGGTCTGG - Intronic
906246379 1:44277429-44277451 GAGAGAAAGGACAAGAGCTGTGG - Intronic
907771196 1:57466064-57466086 GAGACCAAGGACAAATGGCTGGG - Intronic
907862272 1:58364919-58364941 GTAAGAAAGGACAAATGATTTGG - Intronic
908411225 1:63867739-63867761 AGGATAAAGGACAAGTGGTCAGG - Intronic
908558934 1:65285583-65285605 TAGAGAAGGGAAAAATGGTTGGG - Intronic
908576816 1:65468597-65468619 GAGAGAGATGACATTTGGTTGGG + Intronic
909153593 1:72041223-72041245 GAAACAAAGGACAAATGATTAGG - Intronic
909958504 1:81805221-81805243 GAAAAAAAGAACAAGTGCTTGGG + Intronic
910092324 1:83479894-83479916 GTGAGAAAGGACAGTTGATTGGG - Intergenic
910340286 1:86179394-86179416 TTGAGAAATTACAAGTGGTTCGG + Intergenic
910525464 1:88172907-88172929 GAGTCAAAGCACAGGTGGTTGGG - Intergenic
910618868 1:89230722-89230744 CCCAGAAAGGACAAGGGGTTAGG - Intergenic
912484770 1:110017463-110017485 AAAAGAAAGGTCAAGTCGTTAGG - Intronic
912825643 1:112900776-112900798 GAGGGAAATGTCAAGAGGTTGGG + Intergenic
913478238 1:119259695-119259717 GAGAGAAAGCACATGGGCTTTGG - Intergenic
914261115 1:146000055-146000077 GAGAGAAAGGAAAATGGGTAAGG - Intergenic
914760536 1:150594958-150594980 AAGAGAAAGGATAAGTGTTAGGG + Intergenic
916430037 1:164719153-164719175 GTGAGAGAGAACAAATGGTTAGG + Intronic
916697157 1:167250208-167250230 GAGATGAAGAACAAATGGTTGGG + Intronic
917631312 1:176893953-176893975 GAGGCAAAGGAGGAGTGGTTGGG + Intronic
918344979 1:183599392-183599414 GAAAGAAAGAAAAAGAGGTTTGG - Intergenic
918849150 1:189662397-189662419 GAGTGACAGGATGAGTGGTTTGG - Intergenic
918977257 1:191505759-191505781 GAGGGAAAGGAAAAGAGGTCTGG + Intergenic
920077996 1:203350961-203350983 GAAATAAAGGAAAAGTGGTAGGG - Intronic
920224454 1:204428049-204428071 GAGAGAACTGAGAAGAGGTTGGG + Intronic
921326347 1:213989010-213989032 AAGAGAAAGGACAAGGGGACCGG - Intronic
921607498 1:217173037-217173059 GAGAGGGAGGAGAAGTGGGTGGG - Intergenic
922178430 1:223215134-223215156 GAGACAAAGGACACCTGGCTGGG - Intergenic
924350260 1:243107805-243107827 GAGAGAAATGAAAAGGCGTTTGG - Intergenic
924909614 1:248496768-248496790 TAGAGAAAGGCCAAGAGGTGGGG + Intergenic
924914488 1:248551292-248551314 TAGAGAAAGGCCAAGAGGTGGGG - Intergenic
924937350 1:248783549-248783571 GAGAGAGAGGACAGGTGGAAGGG + Intergenic
1064539890 10:16394718-16394740 TTAAGAAAGGAAAAGTGGTTGGG + Intergenic
1066503397 10:36016940-36016962 GAAAGAAAGGAAGAGTAGTTTGG - Intergenic
1067527493 10:47047330-47047352 CAGAGATAGGCCACGTGGTTGGG + Intergenic
1068678979 10:59798523-59798545 GGGATAAAGGACAAGTCTTTGGG + Intronic
1069133231 10:64731933-64731955 TATAGACAGCACAAGTGGTTAGG + Intergenic
1069701361 10:70428923-70428945 CTGAGAAAGGAAAAGTTGTTTGG - Intergenic
1070862762 10:79685667-79685689 GAGAGCAGGGACTAGTGGGTAGG + Intergenic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071523997 10:86347623-86347645 GAGAGCAGGGACAAGGGGTGTGG + Intronic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1071816183 10:89234520-89234542 GAGGGAAGGGGCAAGAGGTTTGG - Intronic
1072748792 10:97961288-97961310 GAGAAAAAGGATAGGTTGTTTGG - Intronic
1073680195 10:105694927-105694949 GAGAGAATGAATAAGTGGTTTGG - Intergenic
1073791225 10:106942365-106942387 AGGAGGAAGGACAAGAGGTTGGG - Intronic
1073959506 10:108910622-108910644 GAGACAAAGAACAAATGGTAGGG - Intergenic
1074100675 10:110352576-110352598 GAGGGAAAGTACAAGTAGGTAGG + Intergenic
1074285982 10:112098660-112098682 GAGAGAAAGGAAATATGGCTAGG - Intergenic
1074504412 10:114055568-114055590 TAGGGAATGGACAAGTAGTTTGG - Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075571209 10:123547583-123547605 AAGAGAAAGCAGGAGTGGTTGGG + Intergenic
1076292877 10:129361291-129361313 GTGAGAAAGGACAGTGGGTTTGG - Intergenic
1077336763 11:2008730-2008752 GAGGGAAAGGAGACGGGGTTGGG + Intergenic
1077613391 11:3658915-3658937 GAGAGAAAAGACTGGTGTTTGGG - Intronic
1077941701 11:6849745-6849767 GAGAGAAATGACAACATGTTAGG - Intergenic
1078738036 11:14039156-14039178 GATAGAAAAGATTAGTGGTTGGG + Intronic
1079529068 11:21427123-21427145 GAGAGTGAGGACAAGCTGTTAGG + Intronic
1081483139 11:43507268-43507290 GAGATAAAGCACAAGTAGGTAGG + Intergenic
1081782859 11:45725354-45725376 AAGAGAAAGGAAAAGTGAGTGGG - Intergenic
1081999156 11:47383509-47383531 GAGAAACAGGACAAGAGGTGAGG + Intergenic
1083800555 11:65044139-65044161 GAGAGGAAGGACAGGGTGTTGGG + Intronic
1084055449 11:66629043-66629065 GAGAAAAATGACAAATGATTTGG - Intronic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1086510809 11:87555820-87555842 GAGTGACAGGGTAAGTGGTTTGG + Intergenic
1087319847 11:96644534-96644556 GAAAGAAAGGATATGTGTTTGGG - Intergenic
1088210701 11:107453302-107453324 GAGCCAATGGACAGGTGGTTGGG + Intronic
1088897156 11:114087230-114087252 GAGAGACAGGAGAACTGGTAAGG - Intronic
1089581091 11:119482445-119482467 GAGACAAAGCACAAGAGGTGTGG + Intergenic
1089624953 11:119745400-119745422 GGGAGAAATGGCAAGGGGTTAGG + Intergenic
1090674525 11:128977614-128977636 TAGAGGAGGGACTAGTGGTTAGG - Intronic
1090942620 11:131401076-131401098 GAGAGACAGGAGAAGTGGAAAGG + Intronic
1202819747 11_KI270721v1_random:63912-63934 GAGGGAAAGGAGACGGGGTTGGG + Intergenic
1092136269 12:6149737-6149759 AAGATAAATGACAACTGGTTTGG - Intergenic
1092792819 12:12084462-12084484 AAGAGAAAGGGCAGGGGGTTGGG - Intronic
1093743731 12:22716132-22716154 GAAAAAAAGGACATTTGGTTAGG + Intergenic
1096881005 12:54670518-54670540 CAGAGAAAATACAAGTGTTTTGG + Intergenic
1096916579 12:55039820-55039842 GAGAGAGAAGCCAAGTGTTTTGG - Intergenic
1097320484 12:58220460-58220482 GAGAGGAGGGCCAAGTGGTGAGG - Intergenic
1097415752 12:59314349-59314371 CAAAGAAATGACAAGTGTTTGGG + Intergenic
1097485722 12:60196708-60196730 GAGAGAGAGAGCAAGTGATTAGG + Intergenic
1098439772 12:70505024-70505046 GAGAGAAAGGAAGAGCGGTGTGG - Intergenic
1099570117 12:84306459-84306481 GAGAGAGAGGAAAAGGGGTCAGG + Intergenic
1101625126 12:106433059-106433081 GAGAGAACAGACAAGTGATAAGG - Intronic
1103196622 12:119049139-119049161 GAGAAAAATGACACGTGGTAAGG + Intronic
1104489932 12:129184841-129184863 GAAAGAAAGGACGAGTGTTTGGG + Intronic
1104816573 12:131649596-131649618 GAAAAAAAGTAAAAGTGGTTGGG - Intergenic
1107039959 13:35937867-35937889 GAAAGAAAGGCAATGTGGTTTGG + Intronic
1107315070 13:39122146-39122168 GTGGGAAAGCAGAAGTGGTTTGG + Intergenic
1108467911 13:50736769-50736791 GAGAGAAAGGAGAAATGGAGAGG + Intronic
1108492690 13:50997180-50997202 GAGAGAAATGAAAAATGGTCAGG - Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1110325681 13:74212273-74212295 AACAGTAAGGACAACTGGTTTGG + Intergenic
1110609448 13:77472590-77472612 GGAAGAAAGGCAAAGTGGTTTGG + Intergenic
1111219868 13:85189982-85190004 GAGTGAAAGGGAAGGTGGTTTGG + Intergenic
1111553399 13:89847363-89847385 GGGAGAAATCAAAAGTGGTTTGG + Intergenic
1112415320 13:99199775-99199797 CAAAGAAATGACAAGTGTTTTGG - Intergenic
1112751099 13:102584056-102584078 GAGAGAGAGAACATGTGGTTTGG + Intergenic
1113428613 13:110230453-110230475 GAGAGAAAGGAAAAGTGGATGGG + Intronic
1113543611 13:111128651-111128673 GAAAGAAAAGACAAATGCTTAGG + Intronic
1114767444 14:25390119-25390141 GAGAGAAAGGAAATGAGGATGGG + Intergenic
1115798188 14:36962076-36962098 TAGAGAAAGGATGAGTGGTTCGG - Intronic
1116318996 14:43435635-43435657 GAGAGAAAGGGGAAGTGGTAGGG + Intergenic
1116703079 14:48264479-48264501 AAGAGTAAGGTCAAGTTGTTAGG + Intergenic
1118203686 14:63701616-63701638 GAGAGCAAGTAGAAGAGGTTAGG + Intronic
1119120247 14:72068789-72068811 GAGAGAAAGGAAGAGTGGGCCGG - Intronic
1119415745 14:74468079-74468101 AAGAGAAAGAACAAGGAGTTTGG - Intergenic
1121714737 14:96065565-96065587 GAGAGAAGGGGAAAGTGGTGGGG - Intronic
1122925480 14:104897629-104897651 GAGTGGAAGGACAAGGGGCTCGG - Intergenic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1125011377 15:34879736-34879758 GAGAGAAGGGACATTTCGTTTGG - Intronic
1125058918 15:35395436-35395458 GAGAGATAGGCCAAGTGATTTGG - Intronic
1125229698 15:37439314-37439336 CAGAGAAAGTTCAAGTGTTTAGG + Intergenic
1125385988 15:39137040-39137062 GAGAAAAGGGAAAACTGGTTTGG - Intergenic
1125752017 15:42035687-42035709 GAGAGAGAGGGGAAGTGATTGGG + Intronic
1126252908 15:46589200-46589222 GAGAGAAAGAACAAGAGGGAAGG + Intergenic
1126554832 15:49974383-49974405 AAAAAAAAGGACAAGTGGCTGGG - Intronic
1126681556 15:51207064-51207086 GAGAGAGGGGACAAGGGCTTTGG + Intergenic
1126810251 15:52395394-52395416 AAGAGAGAGGTCAAGTGGTATGG - Intronic
1127524531 15:59779272-59779294 CAGAGAAATGACAAGTGGCCTGG + Intergenic
1128519724 15:68367360-68367382 TAAAGAAAGGCCATGTGGTTGGG - Intronic
1129604301 15:77017328-77017350 GTGAGAAAGGAGAATTGGGTTGG + Intronic
1129743082 15:77999625-77999647 GGGAGAAAGGACTGGTGGTGGGG - Intronic
1129842398 15:78751815-78751837 GGGAGAAAGGACTGGTGGTGGGG + Intergenic
1129994261 15:79991099-79991121 GACAGAAAGGACAGGTGGGCTGG - Intergenic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1131317575 15:91353544-91353566 GAGAGAAAGGAAAGGTGTTTGGG - Intergenic
1132232334 15:100193378-100193400 GAGAGAGAGGTGAAGTGGGTGGG + Intronic
1135156878 16:20060044-20060066 GAGAGAGAGCACAAGAGGGTTGG - Intronic
1135638615 16:24100621-24100643 AGGAGAAAGGACAGGTGGTGGGG - Intronic
1136672577 16:31872242-31872264 GGGAGAAAAGACAGGAGGTTAGG - Intergenic
1137363684 16:47842376-47842398 AAGAGTAAGGTCAAGTTGTTTGG - Intergenic
1139216046 16:65124238-65124260 GAGAGGATGGACAAGGGGTCCGG + Intronic
1139233508 16:65310060-65310082 TAGAGAAAGGATAAGAGCTTTGG + Intergenic
1140414277 16:74762485-74762507 TAGACATAGGACAAGGGGTTGGG - Intronic
1140697726 16:77551560-77551582 GAATGTGAGGACAAGTGGTTTGG - Intergenic
1141679422 16:85535634-85535656 GGGTGAAAGGAGAAGTGGGTGGG + Intergenic
1143109824 17:4546837-4546859 GAGAGCAATGACAAGGGCTTTGG - Intronic
1143623412 17:8094272-8094294 GAGCAAAGGGAGAAGTGGTTTGG + Intergenic
1144296113 17:13876543-13876565 GAGTGAGGGGACCAGTGGTTAGG - Intergenic
1144481471 17:15633433-15633455 GGGAGAAAGGATAAGTTATTCGG + Intronic
1144916830 17:18730289-18730311 GGGAGAAAGGATAAGTTATTTGG - Intronic
1145910481 17:28539280-28539302 GAAAGAGATGCCAAGTGGTTTGG + Intronic
1146221209 17:31023158-31023180 GAGAGAAAGGACAGTGGGATTGG + Intergenic
1146296279 17:31653151-31653173 AAGAGAAAGGGCAAGGGGGTGGG + Intergenic
1146472484 17:33135574-33135596 GAGAGGTATGACAAGAGGTTGGG + Intronic
1146949207 17:36894096-36894118 GAGAGACAGGACACTTGGCTGGG - Intergenic
1147035437 17:37676402-37676424 GATAGATAGGAGATGTGGTTTGG - Intergenic
1148019254 17:44542557-44542579 GAGAGAGAGGCCAAGGGGGTGGG + Intergenic
1148153188 17:45408553-45408575 TAGAGAAAGGACAAGTGGGGTGG - Intronic
1148676559 17:49448892-49448914 GAGAGAAGGGAGAAGGGGTGAGG + Intronic
1148955158 17:51347574-51347596 GTGAGAAAGGACAGGTGGGAAGG - Intergenic
1149485140 17:57036680-57036702 GAGAGAAAAGCCAGGTGGTGGGG + Intergenic
1151263890 17:72938719-72938741 GAAAGAACAGACAAGTGGCTTGG - Intronic
1151532617 17:74716481-74716503 GAAACATAGCACAAGTGGTTGGG - Intronic
1151652061 17:75476146-75476168 GGGACAAAGGACAGGTAGTTTGG + Intronic
1153345118 18:4017369-4017391 GAAAGAAAGCAGAAATGGTTTGG + Intronic
1153782562 18:8506978-8507000 GTGAGTAAGGGGAAGTGGTTTGG + Intergenic
1154281536 18:13007531-13007553 GACAGAAAGGAAAAGAGGTGGGG - Intronic
1155043109 18:22081769-22081791 AAGACAAAGGACTAGGGGTTGGG - Intergenic
1155672069 18:28383816-28383838 GAGAGAAAGAACAAGAGGCAGGG - Intergenic
1155728134 18:29115747-29115769 GAGAGAAAAGAGAAGAGGTGAGG - Intergenic
1156368492 18:36451508-36451530 GGGAGAAAGGGCAAGCAGTTTGG - Intronic
1156742244 18:40345533-40345555 GAGAGAAAGGGCAGGTGAGTTGG + Intergenic
1156812717 18:41272445-41272467 CATAGAAATGACAAGTGTTTTGG + Intergenic
1158132277 18:54165698-54165720 GAGAGAAAGAGCAGGTGGTAGGG + Intronic
1160000337 18:75013488-75013510 GAGAGAAAAAACATGTGGCTTGG + Intronic
1160192356 18:76724428-76724450 CAGAGAAAGGACAAATGACTAGG + Intergenic
1161310972 19:3593720-3593742 GGTAGAAAGGACCAGTGGCTGGG - Intergenic
1161999648 19:7735179-7735201 AAGAGCAGGGACAAGAGGTTTGG + Intergenic
1162006466 19:7783566-7783588 AAGAGCAGGGACAAGAGGTTTGG - Intergenic
1162127050 19:8505326-8505348 GAAAGAAAGAACAAGTGGCCAGG + Intergenic
1162885025 19:13690559-13690581 GAGACAAAGGAGAAGGGCTTTGG + Intergenic
1163014561 19:14446382-14446404 GAGAGGAAGGCTAGGTGGTTGGG - Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1165065191 19:33224646-33224668 GAGGGACAGGAGAAGTGGTTTGG - Intronic
1166986069 19:46660687-46660709 GTGAGAAAGGACAGGGGGTGGGG - Intronic
925738315 2:6983481-6983503 AAGAGACAGGACTAGTGATTTGG - Intronic
927055645 2:19363400-19363422 GAGAGCAAGGACGTCTGGTTTGG - Intergenic
928427449 2:31190954-31190976 GGGAGAAAGGACAAAGGCTTGGG - Intronic
928673302 2:33624644-33624666 GAGTCAAAGGAAAAGAGGTTTGG - Intergenic
928779496 2:34803078-34803100 AACAGAAAGGTCAAGTTGTTTGG + Intergenic
929471587 2:42199149-42199171 GAGACAAAGGATAAGGGCTTGGG + Intronic
929502949 2:42505712-42505734 AAGAGCAAGGGCAAGTGGGTGGG + Intronic
930011632 2:46941890-46941912 GAGAAAAATCACATGTGGTTTGG + Intronic
930160141 2:48146426-48146448 GAGAGAAAGGACAAGTGTACTGG - Intergenic
930766553 2:55091079-55091101 GAAAGACAGGGCAACTGGTTAGG - Intronic
930815308 2:55590771-55590793 AAGAAAAAGGACAGGTAGTTGGG - Intronic
931590857 2:63881769-63881791 GAGGGAAAGGGCAAGAGGTGGGG - Intronic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932117009 2:69060533-69060555 GTGAGAAAGAACAGGTGGTAAGG + Intronic
932289949 2:70568453-70568475 GAGAGCAAGGCCAAGTGGGGTGG - Intergenic
932289956 2:70568489-70568511 GAGAGAGAGGACAAGAGGGAAGG - Intergenic
932336174 2:70932667-70932689 GAGAGGAAGGGCATGGGGTTGGG - Intronic
932715596 2:74099237-74099259 GGGAGAGAGGACATGGGGTTGGG - Intronic
932776513 2:74531120-74531142 GAGAGAAATGACAAATGATGGGG + Intronic
933313452 2:80688426-80688448 GAGAGAAATGAGGAGTGATTTGG + Intergenic
933617534 2:84498103-84498125 GAGATTCAGGACAAGTTGTTTGG - Intergenic
935575602 2:104707052-104707074 GACAGAAAGCACAATTTGTTTGG - Intergenic
936895107 2:117418739-117418761 GACAGAAAGGACAAGTAGCAGGG + Intergenic
937129133 2:119494212-119494234 CAGAGAAAGGAAGAGTGGTGAGG + Intronic
937752395 2:125492281-125492303 CAAAGAAATGACAAGTGTTTGGG - Intergenic
937847916 2:126601703-126601725 GAGACAGAGGGCAAGTGGTTGGG - Intergenic
938174182 2:129109190-129109212 GAGAGAAAGGAACAGAGGATCGG + Intergenic
938557873 2:132442131-132442153 GAGGGAAGGAAAAAGTGGTTGGG - Intronic
939460526 2:142491952-142491974 AAGAGTAAGGTCAAGTTGTTTGG + Intergenic
939556658 2:143682828-143682850 GCGAAAAAGGAGAAGTGGGTAGG - Intronic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
941237842 2:162997157-162997179 GGAAGAAAGCAAAAGTGGTTGGG - Intergenic
941745577 2:169083298-169083320 GAGAGGAAGGAAAAGAGGTGTGG - Intronic
942853250 2:180516108-180516130 GAGAAAAAGCCCATGTGGTTTGG + Intergenic
943162940 2:184278869-184278891 GAGAGAAAGAACAAGCTGTCTGG + Intergenic
943320816 2:186439949-186439971 TATAGATAGCACAAGTGGTTAGG + Intergenic
944316128 2:198287509-198287531 GAGAGAAAAGGCAAGGGGTCGGG - Intronic
944355149 2:198778750-198778772 AAGACAAAGAACAAGTGGATGGG + Intergenic
944615766 2:201458592-201458614 GAGAGAAGGGAGAAGTGGCTGGG - Intronic
945736310 2:213605014-213605036 GAGAGAAAGGAAAAGAGATTTGG - Intronic
945775578 2:214102842-214102864 GAAAGAAAGGAAAATTCGTTTGG + Intronic
946285394 2:218698824-218698846 TGGATAAAGGACAAGTGGCTGGG - Exonic
946803916 2:223450829-223450851 GAAAGAAAGAAAAAGAGGTTAGG + Intergenic
947094812 2:226554015-226554037 TAGAGAAAGGACAAATGTCTAGG - Intergenic
947811879 2:233009885-233009907 GAGAGACAGGACAGGTGGAGTGG - Intronic
1168739513 20:175832-175854 AAGAGTAAGGTCAAGTTGTTTGG - Intergenic
1169422191 20:5469670-5469692 GAGAGAGGTGGCAAGTGGTTAGG + Intergenic
1171999845 20:31765417-31765439 GAGAAAAAGGACAGGGGGTAGGG - Intronic
1172003895 20:31803805-31803827 GGCAGAGAGGAGAAGTGGTTGGG + Intergenic
1172234265 20:33359338-33359360 GAGAAAAGGGAGAAGTGGCTGGG - Intronic
1173607678 20:44343321-44343343 GAGAGGATGGAAAAGTGGCTCGG - Intronic
1174101414 20:48128920-48128942 AAGAGAAAGGACAGGAGGTAGGG - Intergenic
1174612705 20:51811931-51811953 GAGAGAAAAGCCAACTGGGTAGG + Intergenic
1174900130 20:54490881-54490903 GAGAGAAAGGAAAAGAGGCTGGG - Intronic
1175490181 20:59375095-59375117 GAGAAAAAGGGCAGGTGGGTGGG - Intergenic
1175643255 20:60649310-60649332 GAGAGGGAGGCCAAGTGGTGTGG - Intergenic
1175643264 20:60649340-60649362 GAGAGGGAGGCCAAGTGGTGTGG - Intergenic
1177097153 21:16850039-16850061 GAGACAAAAAACAAATGGTTCGG - Intergenic
1177119787 21:17125088-17125110 AAGAGTAAGGTCAAGTTGTTTGG - Intergenic
1177281848 21:18990851-18990873 AAGAGAAAGGATGAGTGGGTAGG - Intergenic
1177826646 21:26091733-26091755 AAGAGAAAGGAAGAGTGGTTTGG + Intronic
1178253941 21:31033254-31033276 GAGACAAAGGACAAGAGGCAGGG - Intergenic
1178256721 21:31059580-31059602 GAGAGAAAGTAGACATGGTTTGG - Intergenic
1179258547 21:39738652-39738674 GTGACAAAGGAAAAGGGGTTTGG + Intergenic
1179650120 21:42802941-42802963 GACAGTAAGGTCAAGTTGTTTGG + Intergenic
1180655898 22:17420328-17420350 GAGAGAAATGACAAGGGTCTGGG - Intronic
1181550499 22:23636549-23636571 GAGGGAAAGGAGCTGTGGTTGGG + Intergenic
1181823415 22:25493759-25493781 GAGGGAAAGGACACTTGGCTGGG + Intergenic
1182460935 22:30483598-30483620 GAGAGGAATGACAACTGCTTGGG - Intergenic
1183044119 22:35206182-35206204 GAGGGAAAGGCCAAGAGGATTGG - Intergenic
1183137391 22:35902232-35902254 TAGATAATGGAAAAGTGGTTGGG - Intronic
1183300604 22:37057263-37057285 GAGAGAAAGAAGAGGTGGTTGGG - Intronic
1183591070 22:38779570-38779592 GAGACAATGGACAAGAAGTTCGG - Exonic
1184017853 22:41799675-41799697 CAGAGAAAGGCCTAGGGGTTGGG + Intergenic
1184684605 22:46090466-46090488 GAGAGAAAGGCCTAGGGTTTGGG - Intronic
1184790567 22:46697139-46697161 GAGAGAAAGAAATAGTGATTTGG - Intronic
949431903 3:3985852-3985874 GAGAGAAAGGAAATGTCCTTGGG - Intronic
949947074 3:9198738-9198760 GAGAGAAAGGACAAGGCCTCTGG - Intronic
950528568 3:13539310-13539332 GACAGGAAGCCCAAGTGGTTAGG + Intergenic
950817903 3:15726409-15726431 CAGAGAAAGTACTAGTGGTCTGG + Intronic
951357928 3:21691512-21691534 GAAAGAAAGGAGAAAAGGTTGGG - Intronic
951637964 3:24800261-24800283 GAGAGAAATGACAAGAGGGAGGG - Intergenic
952159864 3:30682689-30682711 CCCAGAAAGGACAAGTGTTTGGG + Intronic
952508304 3:34028115-34028137 CAGAGAAAGAACAAGAGGGTCGG - Intergenic
952792088 3:37207897-37207919 AAGAGTAAGGTCAAGTTGTTTGG - Intergenic
953343429 3:42155177-42155199 GAGACAAAGGAAAACGGGTTTGG + Intronic
953534557 3:43767723-43767745 AAAAGAAAGGATATGTGGTTAGG + Intergenic
953703451 3:45213993-45214015 GAGGGAAAGGAACAGGGGTTTGG - Intergenic
954697875 3:52437069-52437091 GAGGGCAAGGACCAGTGGTTAGG + Intronic
955538516 3:59950331-59950353 GAGAGGAAGGACAGGTGATGAGG - Intronic
956728128 3:72173392-72173414 GAGGGAAAGGAAAAGTGATATGG - Intergenic
956745937 3:72311081-72311103 GATAGAAAGGACAAGAGGACAGG - Intergenic
957355999 3:79087433-79087455 GAGAGAAAGAAAAATTGGTTAGG - Intronic
958174133 3:89973658-89973680 GAGAGAAAGAAAAACTGGATAGG - Intergenic
959279309 3:104317331-104317353 GAAAGAAAGGAAAAGTGGAAAGG + Intergenic
959352511 3:105283758-105283780 GAGAGAAAGGAATAGAAGTTAGG - Intergenic
960447805 3:117769028-117769050 GAGAGAAAGGATATGTGGTTTGG - Intergenic
961712503 3:128838446-128838468 AAGAGTAAGGTCAAGTTGTTTGG + Intergenic
962433016 3:135338031-135338053 AAGAGAAAGAAGAACTGGTTTGG + Intergenic
963520684 3:146357363-146357385 GACAGTAAGGTCAAGTTGTTTGG - Intergenic
964497203 3:157303965-157303987 GATAGAAATGACAAGTGCTGTGG - Intronic
967219439 3:187236426-187236448 GTGCCAAATGACAAGTGGTTTGG - Exonic
967903426 3:194481158-194481180 GATATAAAAGACAAGTGTTTTGG - Intronic
969481370 4:7448751-7448773 GAGAGAAAGGAAAAGAGGGAGGG - Intronic
969914457 4:10476231-10476253 TTGAGAAAGGACAAATGATTTGG - Intergenic
969916755 4:10498977-10498999 GAGAAAAAGGACAAGGGTTGGGG - Intronic
970290418 4:14565143-14565165 GAGAGAAAAGAAAAGGGGATTGG + Intergenic
971663415 4:29450251-29450273 GAGAGAAATGAAAAGTGGTCTGG - Intergenic
972046963 4:34678112-34678134 TAGAGAAAGAACAATTGGTGAGG - Intergenic
972693694 4:41423860-41423882 GAGAGAAGGGAAAGGTGGGTTGG + Intronic
972792206 4:42384014-42384036 GGGAGAAAAGAAAAGAGGTTGGG - Intergenic
973154205 4:46928710-46928732 GAGAAAAAGAACAAATGCTTTGG - Exonic
973627805 4:52790454-52790476 GAAAGAAAGAACAAATGGGTGGG - Intergenic
975210527 4:71694798-71694820 GACAAAAAGAACAAATGGTTTGG - Intergenic
976234749 4:82884476-82884498 GTGAGAAAGGTTATGTGGTTGGG - Intronic
976778953 4:88737587-88737609 GAGGGAAAGGGAAAGGGGTTCGG - Intronic
977790796 4:101100195-101100217 GACAGAAAAGACAAGATGTTGGG + Intronic
978500926 4:109409307-109409329 GAGGGAAAAGATAAGTGGTCTGG + Intergenic
978752529 4:112267588-112267610 GACAGAAAGGCTAAGTGATTTGG - Intronic
978859559 4:113431821-113431843 GAGAGATAAGAAATGTGGTTAGG + Intergenic
979251677 4:118572747-118572769 GAGAGAAATGAAAAGGCGTTTGG + Intergenic
979841347 4:125445158-125445180 GAAAGAATAGAGAAGTGGTTTGG - Intronic
980003149 4:127513585-127513607 AACAGAAAGGTCAAGTTGTTTGG + Intergenic
980025527 4:127761518-127761540 GAGAGAAAGAACAGGTGACTTGG - Intronic
980417062 4:132503875-132503897 AAAAGAAAGGGAAAGTGGTTTGG + Intergenic
980792856 4:137642183-137642205 GAGACATAGAACAAGTGGTAGGG - Intergenic
982245410 4:153345183-153345205 GAGAGAAAGCGCAAGTGGGCGGG + Intronic
982973285 4:162018181-162018203 GGTAGAAAGGGCATGTGGTTAGG + Intronic
985349505 4:189043054-189043076 CAGAGAAAGCACAAATGGCTGGG + Intergenic
985479093 5:96080-96102 GAGACAAAGGACATTTGGTGTGG + Intergenic
987001836 5:13667744-13667766 GAAGGAAAAGAAAAGTGGTTGGG + Intergenic
987256112 5:16153322-16153344 GAAAACAAGGACAACTGGTTTGG + Intronic
987992054 5:25225635-25225657 GGAAGGAAGGACAAGTGTTTGGG - Intergenic
988350014 5:30090868-30090890 GAAAGAGAGCACAAGTGGTTTGG - Intergenic
989261862 5:39427562-39427584 GAGAGAAAGGATAAAGGATTAGG - Intronic
990564925 5:57019262-57019284 AAGAGTAAGGTCAAGTTGTTTGG + Intergenic
990721876 5:58705723-58705745 GAGAGAGAGTGCAAGTGGGTAGG - Intronic
990954314 5:61328729-61328751 AAGAGAAAGGACAATGGCTTAGG + Intergenic
991537097 5:67681624-67681646 CAAAGAAAGGACAAATGGGTGGG - Intergenic
992126587 5:73648812-73648834 GAGAGACAGGATGAGTGGTGTGG - Intronic
995076402 5:107989979-107990001 GAGAGAAATGAAAAGGGGTTAGG - Intronic
995502672 5:112824873-112824895 GAGAGAAAGGAAAAGAGCCTAGG - Intronic
996659993 5:125990506-125990528 GAGAAAAATATCAAGTGGTTAGG - Intergenic
996723079 5:126648678-126648700 AACAGAAAGGTCAAGTTGTTTGG - Intergenic
996725666 5:126671856-126671878 AAGAGTAAGGTCAAGTTGTTTGG + Intergenic
996858343 5:128035859-128035881 GAGAGGCAGGATAAGTGGCTGGG + Intergenic
997670633 5:135668957-135668979 GGGAGGCAGGACAAGTGTTTGGG + Intergenic
997893617 5:137696317-137696339 GAAAGAAAGGAAAAGAGGTGGGG + Intronic
998113862 5:139521962-139521984 GAGAGAAAGGATGACGGGTTGGG - Intergenic
998995598 5:147866886-147866908 AAGAGTAAGGTCAAGTTGTTTGG - Intergenic
1001890137 5:175331827-175331849 GTTAGGAAGGCCAAGTGGTTGGG - Intergenic
1001890157 5:175331939-175331961 GTTAGTAAGGCCAAGTGGTTGGG - Intergenic
1001890190 5:175332122-175332144 GTTAGTAAGGCCAAGTGGTTGGG - Intergenic
1001890212 5:175332250-175332272 GTTAGTAAGGCCAAGTGGTTGGG - Intergenic
1004106471 6:12670957-12670979 AACAGTAAGGACAAGTTGTTTGG - Intergenic
1004360835 6:14969344-14969366 TAGACAAAGGAAAAGGGGTTTGG + Intergenic
1005747815 6:28855304-28855326 TAGAAAAAGGACAATTGGCTGGG - Intergenic
1006291720 6:33143026-33143048 GTGAGGAAGGACATGAGGTTTGG + Intergenic
1007417270 6:41699059-41699081 GTGGGAAAGGCCAAGTGCTTGGG + Intronic
1007847138 6:44768654-44768676 GAGAGAAACACCAAGCGGTTGGG + Intergenic
1008379651 6:50826667-50826689 GAGTGAAAGGACACCTAGTTTGG + Intronic
1010135433 6:72546683-72546705 GAGAGACAAGAAAACTGGTTAGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1011569942 6:88724843-88724865 GAGTGACAGGATGAGTGGTTTGG - Intronic
1012948523 6:105493056-105493078 GAGAGAAAGGAACATTGGCTGGG + Intergenic
1013430605 6:110051882-110051904 GACAGTAAGCACAAATGGTTAGG + Intergenic
1015145870 6:129986234-129986256 GATAAAAGGGACAACTGGTTGGG + Intergenic
1016107900 6:140185621-140185643 GAGAGAAAGAACAAGCAATTTGG + Intergenic
1017335570 6:153255508-153255530 GAGATAAAGGACATTTGGCTGGG - Intergenic
1018174356 6:161166176-161166198 GAGCAAAAAGACAAGTGGTGGGG + Intronic
1018572930 6:165229774-165229796 CAGAGAAAGATCAAGTGGTGAGG + Intergenic
1018953041 6:168391445-168391467 GAGAGACAGGACAGGTGTGTTGG - Intergenic
1019505962 7:1391265-1391287 GTGATTAAGGACAAGTAGTTTGG - Intergenic
1019521227 7:1461370-1461392 GGGAGAAAGGACCATTTGTTTGG - Intergenic
1021174389 7:17434351-17434373 GAGTCAGAGGACAAATGGTTTGG + Intergenic
1021234049 7:18120614-18120636 GGGAGAAAAGACAGGGGGTTTGG + Intronic
1021756539 7:23858236-23858258 GAGAGAAAGGTATAGGGGTTGGG + Intergenic
1022547569 7:31203007-31203029 CAGCGAAAGCAAAAGTGGTTCGG + Intergenic
1023528413 7:41129270-41129292 GAGAGAAAGAGAAAGAGGTTGGG - Intergenic
1025992088 7:66504195-66504217 GAGAGAAAGGCCACTTGGATGGG - Intergenic
1026099336 7:67371757-67371779 CAGAGCAATTACAAGTGGTTAGG + Intergenic
1026627802 7:72011657-72011679 GAGAGAAAGGAAAGATGATTAGG - Intronic
1027309184 7:76936373-76936395 GTGAGAAAGGACAGTTGATTGGG - Intergenic
1027966122 7:85010886-85010908 CAGAGAATGGAAAAGTGGCTGGG + Intronic
1029174248 7:98652718-98652740 GAGAGAAAGGGGAAGATGTTGGG - Intergenic
1030278621 7:107745745-107745767 GAGAGAAAGGAGAAATGCCTAGG + Intronic
1031291208 7:119938281-119938303 AAGGGAAAGGCAAAGTGGTTTGG + Intergenic
1031780693 7:125959437-125959459 CAGAGAAAGCACAAGCTGTTGGG + Intergenic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032520297 7:132538739-132538761 GAGATAATGGACAAGGGGTGCGG - Intronic
1033084912 7:138332463-138332485 AAGAGTAAGGCCAAGTTGTTTGG - Intergenic
1033088799 7:138366333-138366355 AAGAGTAAGGTCAAGTTGTTTGG - Intergenic
1033216369 7:139496301-139496323 GAGAAAAGGGACACGTGGTTTGG - Intergenic
1035092572 7:156326496-156326518 GAGAGTAACGACAATTGGTAAGG - Intergenic
1035279513 7:157768801-157768823 GAAAATAAGGACAAGTGATTGGG + Intronic
1036632607 8:10525858-10525880 GAGAGAAAGGACAAGTGGTTTGG - Intronic
1037819493 8:22128896-22128918 GAGAGGAAGGTCAACTGGCTGGG - Exonic
1038139434 8:24827125-24827147 AAGAGAAATGACAAGAGGTCAGG + Intergenic
1039261668 8:35778413-35778435 GAGAGAAAAGACAATGGTTTGGG - Intronic
1040066966 8:43153543-43153565 CAAAGAAATGACAAGTGTTTTGG - Intronic
1040399065 8:47029953-47029975 GAGAGAAAGGAGAGGTGGGGTGG + Intergenic
1041992173 8:64006374-64006396 AAGAAAAAGGGCAAGTGTTTTGG - Intergenic
1042309456 8:67365868-67365890 GTGAGAAATGATAAGTGATTGGG - Intergenic
1043374431 8:79632459-79632481 AAGAGAAAGGAAAAGTGGAGAGG + Intronic
1044066948 8:87710021-87710043 CAAAGAAAGGACAAATGCTTGGG + Intergenic
1045341224 8:101256205-101256227 GAAACAAAAGACAGGTGGTTTGG + Intergenic
1045713138 8:105010142-105010164 AACGGAAAGGACAACTGGTTAGG - Intronic
1047139529 8:122121937-122121959 GAGAGAAAGGAAAAGAGGGATGG - Intergenic
1047508821 8:125500582-125500604 GAGAAAAAGGTCAAGTCTTTAGG - Intergenic
1050256999 9:3804416-3804438 GAGAGAAAGGAGAAGTTGTTTGG - Intergenic
1050462215 9:5886567-5886589 GAGATGAAGTGCAAGTGGTTTGG + Intronic
1051008117 9:12374170-12374192 GAGAGAAGGGCCAAGAGGTAAGG - Intergenic
1051334915 9:16057609-16057631 GAGACAAGGGACAAGGGTTTTGG - Intronic
1051596097 9:18825688-18825710 GAGAAATGGGACAAGTGGCTTGG - Intronic
1053336998 9:37283754-37283776 AACAGAAAGGACAGTTGGTTTGG + Intronic
1054327709 9:63722544-63722566 GAGGGAAAGGAAAATTAGTTGGG + Intergenic
1056373732 9:85986165-85986187 GAGAGAACTGACAAATGGTTTGG + Intronic
1056482057 9:87015916-87015938 GAGAGAGAGAACAAGTGGGAGGG + Intergenic
1057811487 9:98260280-98260302 GAGAGAAAGGACAACTAGAAAGG + Intergenic
1057940791 9:99281929-99281951 GAAAGAAAGGAAAAGAGGCTTGG - Intergenic
1058709521 9:107667291-107667313 GAGAGAAGGGGAAAGTGATTAGG - Intergenic
1059620305 9:115997385-115997407 GAGAGAAGTGACAAGTGGCTTGG + Intergenic
1059817501 9:117934016-117934038 GTGAGAAAGTACAAGTGGGAAGG + Intergenic
1060493554 9:124101907-124101929 GCAAGAAAGGACAAGTGGGAGGG + Intergenic
1061019941 9:128007879-128007901 GTGAGAGAGGCCAAGTGGCTGGG - Intergenic
1061200377 9:129134897-129134919 GAGAGAAAGGACAGGAGGGTTGG + Intronic
1061414030 9:130436239-130436261 GACAGAAAGGTCAAGGGGGTGGG + Intergenic
1061835735 9:133328346-133328368 CAGAGACAGGACAACTGGGTGGG - Intergenic
1062111797 9:134785908-134785930 GAGAGAAAGGACATGCGTTCTGG - Intronic
1186198083 X:7130013-7130035 GAGTGAAAAGAAAAGTGCTTTGG - Intronic
1186754675 X:12658055-12658077 CATAGAAAGGAAAAGTGGCTCGG + Intronic
1187693908 X:21899170-21899192 GAGAGAAATGACTTTTGGTTAGG - Intergenic
1189205384 X:39233902-39233924 GAAACAAAGGACTAATGGTTAGG - Intergenic
1189400922 X:40667770-40667792 GTGAGAGAGGACTAGTGGCTTGG + Intronic
1190329464 X:49226710-49226732 GAGAGAAAGGACAATTAGGGAGG + Intronic
1191645107 X:63471613-63471635 AAGAGGAAGGTCAACTGGTTAGG + Intergenic
1191898117 X:66014984-66015006 GAGTGAAAGAACATGTGATTTGG + Intergenic
1193145250 X:78069308-78069330 TATAGATAGCACAAGTGGTTAGG + Intronic
1195656014 X:107332268-107332290 TAGAGAAAAGACAAATGGTAAGG - Intergenic
1195850627 X:109278300-109278322 TAGTGAAAGGGCCAGTGGTTTGG + Intergenic
1196305999 X:114104026-114104048 TAGACAAAGGAAAAGAGGTTTGG - Intergenic
1196966165 X:121057594-121057616 GAGAGAAACCACAATTGGTAAGG + Intergenic
1197821349 X:130543963-130543985 GAGAGAAAGGTCAAAGGGTTTGG + Intergenic
1198216873 X:134563570-134563592 CAGAGAAAGTGCAAGTGGTCTGG - Intergenic
1198897389 X:141470792-141470814 GAGAGAAAGCACAATCTGTTTGG - Intergenic
1199273344 X:145912113-145912135 GAGAAAAAGGACATGTAGTGAGG + Intergenic
1199504961 X:148551517-148551539 GAAAGAAAGGAAAAGAGATTGGG + Intronic
1199558496 X:149136514-149136536 GAGAGAAAGTAAAAGAGATTAGG - Intergenic
1199862787 X:151816830-151816852 GAGAGAAGGGACAACTGATAAGG - Intergenic
1200813082 Y:7504543-7504565 GACAGTAAGGTCAAGTTGTTTGG - Intergenic