ID: 1036635415

View in Genome Browser
Species Human (GRCh38)
Location 8:10547163-10547185
Sequence TGTCGAGTGACAAGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036635415_1036635421 17 Left 1036635415 8:10547163-10547185 CCCGCCACCCTTGTCACTCGACA No data
Right 1036635421 8:10547203-10547225 CTTTCCAGAGTGAGCCGCCGAGG No data
1036635415_1036635423 19 Left 1036635415 8:10547163-10547185 CCCGCCACCCTTGTCACTCGACA No data
Right 1036635423 8:10547205-10547227 TTCCAGAGTGAGCCGCCGAGGGG No data
1036635415_1036635422 18 Left 1036635415 8:10547163-10547185 CCCGCCACCCTTGTCACTCGACA No data
Right 1036635422 8:10547204-10547226 TTTCCAGAGTGAGCCGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036635415 Original CRISPR TGTCGAGTGACAAGGGTGGC GGG (reversed) Intronic