ID: 1036638058

View in Genome Browser
Species Human (GRCh38)
Location 8:10564964-10564986
Sequence TGGGGGTTCCTGATCTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036638042_1036638058 23 Left 1036638042 8:10564918-10564940 CCTGGAGAAGACCACGGCACCGT No data
Right 1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG No data
1036638044_1036638058 12 Left 1036638044 8:10564929-10564951 CCACGGCACCGTGATGCCGGTGG No data
Right 1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG No data
1036638049_1036638058 4 Left 1036638049 8:10564937-10564959 CCGTGATGCCGGTGGGGCGGTGG No data
Right 1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG No data
1036638041_1036638058 28 Left 1036638041 8:10564913-10564935 CCAGGCCTGGAGAAGACCACGGC No data
Right 1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG No data
1036638053_1036638058 -4 Left 1036638053 8:10564945-10564967 CCGGTGGGGCGGTGGCGGATGGG No data
Right 1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036638058 Original CRISPR TGGGGGTTCCTGATCTATCA GGG Intergenic
No off target data available for this crispr