ID: 1036639160

View in Genome Browser
Species Human (GRCh38)
Location 8:10571533-10571555
Sequence CAGAGCAAAGAGCAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036639160_1036639163 4 Left 1036639160 8:10571533-10571555 CCGTCCTCCTGCTCTTTGCTCTG No data
Right 1036639163 8:10571560-10571582 AAAAGTCCACCTACGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036639160 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr