ID: 1036641549

View in Genome Browser
Species Human (GRCh38)
Location 8:10587421-10587443
Sequence CCCATGGGAGCTCTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036641549_1036641556 28 Left 1036641549 8:10587421-10587443 CCTGAAGACAGAGCTCCCATGGG No data
Right 1036641556 8:10587472-10587494 GCTAGCTGTTTAGCAGTAGAGGG No data
1036641549_1036641555 27 Left 1036641549 8:10587421-10587443 CCTGAAGACAGAGCTCCCATGGG No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036641549 Original CRISPR CCCATGGGAGCTCTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr