ID: 1036641555

View in Genome Browser
Species Human (GRCh38)
Location 8:10587471-10587493
Sequence TGCTAGCTGTTTAGCAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036641553_1036641555 -8 Left 1036641553 8:10587456-10587478 CCCTCACAGCTGTCATGCTAGCT No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data
1036641547_1036641555 28 Left 1036641547 8:10587420-10587442 CCCTGAAGACAGAGCTCCCATGG No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data
1036641551_1036641555 12 Left 1036641551 8:10587436-10587458 CCCATGGGAAAGCTGTGCAGCCC No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data
1036641552_1036641555 11 Left 1036641552 8:10587437-10587459 CCATGGGAAAGCTGTGCAGCCCT No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data
1036641549_1036641555 27 Left 1036641549 8:10587421-10587443 CCTGAAGACAGAGCTCCCATGGG No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data
1036641554_1036641555 -9 Left 1036641554 8:10587457-10587479 CCTCACAGCTGTCATGCTAGCTG No data
Right 1036641555 8:10587471-10587493 TGCTAGCTGTTTAGCAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036641555 Original CRISPR TGCTAGCTGTTTAGCAGTAG AGG Intergenic
No off target data available for this crispr