ID: 1036642300

View in Genome Browser
Species Human (GRCh38)
Location 8:10592075-10592097
Sequence CAGGCAGAGGCAGCTGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036642300_1036642307 17 Left 1036642300 8:10592075-10592097 CCAAGAGCAGCTGCCTCTGCCTG No data
Right 1036642307 8:10592115-10592137 CCCACCCTCCCAGCCGGAACGGG No data
1036642300_1036642315 30 Left 1036642300 8:10592075-10592097 CCAAGAGCAGCTGCCTCTGCCTG No data
Right 1036642315 8:10592128-10592150 CCGGAACGGGAATCCTCACCGGG No data
1036642300_1036642313 29 Left 1036642300 8:10592075-10592097 CCAAGAGCAGCTGCCTCTGCCTG No data
Right 1036642313 8:10592127-10592149 GCCGGAACGGGAATCCTCACCGG No data
1036642300_1036642304 11 Left 1036642300 8:10592075-10592097 CCAAGAGCAGCTGCCTCTGCCTG No data
Right 1036642304 8:10592109-10592131 TATAATCCCACCCTCCCAGCCGG No data
1036642300_1036642305 16 Left 1036642300 8:10592075-10592097 CCAAGAGCAGCTGCCTCTGCCTG No data
Right 1036642305 8:10592114-10592136 TCCCACCCTCCCAGCCGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036642300 Original CRISPR CAGGCAGAGGCAGCTGCTCT TGG (reversed) Intergenic