ID: 1036642556

View in Genome Browser
Species Human (GRCh38)
Location 8:10593272-10593294
Sequence AAGGTCTCCTGGTCCCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036642556_1036642560 2 Left 1036642556 8:10593272-10593294 CCGGGTGGGGACCAGGAGACCTT No data
Right 1036642560 8:10593297-10593319 CATTTGCTGCCGTGGTCCAACGG No data
1036642556_1036642565 30 Left 1036642556 8:10593272-10593294 CCGGGTGGGGACCAGGAGACCTT No data
Right 1036642565 8:10593325-10593347 TGCCTCTCCCTCACATACGCAGG No data
1036642556_1036642558 -6 Left 1036642556 8:10593272-10593294 CCGGGTGGGGACCAGGAGACCTT No data
Right 1036642558 8:10593289-10593311 GACCTTTGCATTTGCTGCCGTGG No data
1036642556_1036642561 3 Left 1036642556 8:10593272-10593294 CCGGGTGGGGACCAGGAGACCTT No data
Right 1036642561 8:10593298-10593320 ATTTGCTGCCGTGGTCCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036642556 Original CRISPR AAGGTCTCCTGGTCCCCACC CGG (reversed) Intergenic
No off target data available for this crispr