ID: 1036642812

View in Genome Browser
Species Human (GRCh38)
Location 8:10594597-10594619
Sequence ATGAACTTCTCCACGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036642812_1036642821 16 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642821 8:10594636-10594658 AAAAAGCCTGAGGCAGGGGCTGG No data
1036642812_1036642824 26 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642824 8:10594646-10594668 AGGCAGGGGCTGGGTGCCAGTGG No data
1036642812_1036642822 17 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642822 8:10594637-10594659 AAAAGCCTGAGGCAGGGGCTGGG No data
1036642812_1036642818 10 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642818 8:10594630-10594652 TGGTTGAAAAAGCCTGAGGCAGG No data
1036642812_1036642819 11 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642819 8:10594631-10594653 GGTTGAAAAAGCCTGAGGCAGGG No data
1036642812_1036642816 6 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642816 8:10594626-10594648 GCCATGGTTGAAAAAGCCTGAGG No data
1036642812_1036642815 -10 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642815 8:10594610-10594632 AGAAGTTCATGTCTTAGCCATGG No data
1036642812_1036642820 12 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642820 8:10594632-10594654 GTTGAAAAAGCCTGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036642812 Original CRISPR ATGAACTTCTCCACGGCTCA GGG (reversed) Intergenic
No off target data available for this crispr