ID: 1036642813

View in Genome Browser
Species Human (GRCh38)
Location 8:10594598-10594620
Sequence CATGAACTTCTCCACGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036642813_1036642819 10 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642819 8:10594631-10594653 GGTTGAAAAAGCCTGAGGCAGGG No data
1036642813_1036642816 5 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642816 8:10594626-10594648 GCCATGGTTGAAAAAGCCTGAGG No data
1036642813_1036642824 25 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642824 8:10594646-10594668 AGGCAGGGGCTGGGTGCCAGTGG No data
1036642813_1036642822 16 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642822 8:10594637-10594659 AAAAGCCTGAGGCAGGGGCTGGG No data
1036642813_1036642821 15 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642821 8:10594636-10594658 AAAAAGCCTGAGGCAGGGGCTGG No data
1036642813_1036642820 11 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642820 8:10594632-10594654 GTTGAAAAAGCCTGAGGCAGGGG No data
1036642813_1036642818 9 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642818 8:10594630-10594652 TGGTTGAAAAAGCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036642813 Original CRISPR CATGAACTTCTCCACGGCTC AGG (reversed) Intergenic
No off target data available for this crispr