ID: 1036642815

View in Genome Browser
Species Human (GRCh38)
Location 8:10594610-10594632
Sequence AGAAGTTCATGTCTTAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036642812_1036642815 -10 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642815 8:10594610-10594632 AGAAGTTCATGTCTTAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036642815 Original CRISPR AGAAGTTCATGTCTTAGCCA TGG Intergenic
No off target data available for this crispr