ID: 1036642822

View in Genome Browser
Species Human (GRCh38)
Location 8:10594637-10594659
Sequence AAAAGCCTGAGGCAGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036642814_1036642822 10 Left 1036642814 8:10594604-10594626 CCGTGGAGAAGTTCATGTCTTAG No data
Right 1036642822 8:10594637-10594659 AAAAGCCTGAGGCAGGGGCTGGG No data
1036642812_1036642822 17 Left 1036642812 8:10594597-10594619 CCCTGAGCCGTGGAGAAGTTCAT No data
Right 1036642822 8:10594637-10594659 AAAAGCCTGAGGCAGGGGCTGGG No data
1036642813_1036642822 16 Left 1036642813 8:10594598-10594620 CCTGAGCCGTGGAGAAGTTCATG No data
Right 1036642822 8:10594637-10594659 AAAAGCCTGAGGCAGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036642822 Original CRISPR AAAAGCCTGAGGCAGGGGCT GGG Intergenic
No off target data available for this crispr