ID: 1036645480

View in Genome Browser
Species Human (GRCh38)
Location 8:10609375-10609397
Sequence CTCTCTTGGTGCTGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 352}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645471_1036645480 5 Left 1036645471 8:10609347-10609369 CCCGCCCGGCCCTGGAGCTTCTG 0: 1
1: 0
2: 6
3: 46
4: 392
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645477_1036645480 -5 Left 1036645477 8:10609357-10609379 CCTGGAGCTTCTGGAGCTCTCTC 0: 1
1: 0
2: 6
3: 34
4: 299
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645475_1036645480 0 Left 1036645475 8:10609352-10609374 CCGGCCCTGGAGCTTCTGGAGCT 0: 1
1: 2
2: 2
3: 48
4: 407
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645474_1036645480 1 Left 1036645474 8:10609351-10609373 CCCGGCCCTGGAGCTTCTGGAGC 0: 1
1: 0
2: 6
3: 40
4: 491
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645470_1036645480 9 Left 1036645470 8:10609343-10609365 CCTACCCGCCCGGCCCTGGAGCT 0: 1
1: 0
2: 1
3: 33
4: 428
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645476_1036645480 -4 Left 1036645476 8:10609356-10609378 CCCTGGAGCTTCTGGAGCTCTCT 0: 1
1: 0
2: 6
3: 27
4: 257
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645472_1036645480 4 Left 1036645472 8:10609348-10609370 CCGCCCGGCCCTGGAGCTTCTGG 0: 1
1: 0
2: 5
3: 34
4: 339
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645466_1036645480 19 Left 1036645466 8:10609333-10609355 CCAGCACCATCCTACCCGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645465_1036645480 30 Left 1036645465 8:10609322-10609344 CCTTGGAGGCTCCAGCACCATCC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645468_1036645480 13 Left 1036645468 8:10609339-10609361 CCATCCTACCCGCCCGGCCCTGG 0: 1
1: 0
2: 1
3: 33
4: 380
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645480 Original CRISPR CTCTCTTGGTGCTGTCCTGG AGG Exonic
900181754 1:1314178-1314200 CCTGCTTGCTGCTGTCCTGGGGG - Intronic
901383377 1:8890164-8890186 CTCTCTCGGTCCTGTCCTCAGGG + Intergenic
902776059 1:18675822-18675844 TTCTCTTGGTGGTGTCTCGGGGG + Intronic
903567956 1:24283351-24283373 CTCCCATGCTGCTGCCCTGGAGG + Intergenic
903845418 1:26277129-26277151 GTCTCTGGGTGCTGTGCTGCTGG - Exonic
905597929 1:39224642-39224664 CTCTCCTGGTTCTCTCCTGTTGG - Intronic
905804804 1:40868561-40868583 CTCTCTGGGAGCTGACCTAGTGG - Intergenic
905841015 1:41178203-41178225 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
906146765 1:43565154-43565176 CTATCTTGGTGGCTTCCTGGAGG - Intronic
906374780 1:45286514-45286536 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
907279067 1:53333341-53333363 CTGTCTGGGGGCTGTCTTGGAGG + Intergenic
907310439 1:53535894-53535916 GTCCCTTGGTGCTGGCTTGGTGG + Intronic
910445209 1:87292876-87292898 CTCTCTTTGAGCTCTCCTTGAGG - Intergenic
910643966 1:89492932-89492954 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
910738106 1:90484577-90484599 ATGGCTTGGTGCTGTCCTCGAGG + Intergenic
911144412 1:94538820-94538842 ATCTCTTGCTGCTGTACTGGAGG - Intronic
912449069 1:109758538-109758560 CTCTGGTGGGGCTGTTCTGGAGG + Exonic
913352190 1:117874260-117874282 ATGTCTTGGTGCTGTCCTTGTGG + Intronic
913352462 1:117876182-117876204 ATGGCTTGGTGCTGTCCTTGTGG + Intronic
914954564 1:152149236-152149258 ATGTCTTGGTGATGTCCTTGTGG - Intergenic
915782878 1:158572488-158572510 CTCTCTTTCTGCTTTCCTGATGG - Intergenic
916692955 1:167208756-167208778 ATATCTTGGTGCTGTCCTTGTGG - Intergenic
917275256 1:173324328-173324350 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
918910230 1:190558575-190558597 ATGGCTTGGTGCTGTCCTTGTGG + Intergenic
919048583 1:192484254-192484276 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic
919918973 1:202157002-202157024 CTCTCTGGGAGCCCTCCTGGTGG + Intronic
921711984 1:218382013-218382035 CTCTCTTTCTGCTGACCTGCAGG - Intronic
922592079 1:226784910-226784932 CTGTCTTGCTGCTGGCCTTGGGG + Intergenic
924586961 1:245368513-245368535 CTCACTTGGGTCTGTCATGGTGG + Intronic
924857815 1:247892497-247892519 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1062912211 10:1218692-1218714 TCCCCTTGGTGCTGTCCTCGTGG + Intronic
1062953779 10:1526471-1526493 TTATCTTGGTGCTGTCCTCCTGG + Intronic
1063264059 10:4426173-4426195 ATGTCTCGGTGCTGTCCTGGAGG + Intergenic
1063291714 10:4756438-4756460 CCCTCTTGGTGCTGTCCTCCTGG + Intergenic
1065727602 10:28680818-28680840 AACTCTTGGTGCAGTCCTGTGGG + Intronic
1066001699 10:31110559-31110581 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1066238953 10:33515027-33515049 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1066813423 10:39371293-39371315 CTCTTTTAGGGCTGGCCTGGTGG + Intergenic
1066818301 10:39450661-39450683 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1067383425 10:45796245-45796267 ATGTCTTGGTGCTGTCCTTGTGG + Intergenic
1067468854 10:46521993-46522015 ATGGCTTGGTGCTGTCCTAGAGG - Intergenic
1067880745 10:50042548-50042570 ATGTCTTGGTGCTGCCCTTGTGG - Intergenic
1067891129 10:50136811-50136833 ATGTCTTGGTGCTGTCCTTGTGG + Intergenic
1067955489 10:50786624-50786646 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1068142957 10:53028989-53029011 TTCTCTTGGTCCTGGCCTAGAGG - Intergenic
1068256406 10:54517025-54517047 CTCTTTTGGGGCAGGCCTGGTGG - Intronic
1069655312 10:70083408-70083430 TTCTCCTGCTGATGTCCTGGGGG + Intronic
1071375197 10:84995352-84995374 ATGTCTTGGTGCTGTTCTGGAGG - Intergenic
1071728900 10:88228209-88228231 CTCTTTTGCTGCTTTCCTAGTGG + Intergenic
1071817914 10:89251732-89251754 CTCACCTGGAGCTGTCCTGCCGG + Exonic
1071876970 10:89852743-89852765 GTCACTTGGTGATGTCCTGATGG - Intergenic
1071934308 10:90509801-90509823 ATCACTTGGTGCTGTCCTCATGG - Intergenic
1072485351 10:95849451-95849473 CTCTCTTGCTGGGGTCCTGGAGG - Intronic
1073587382 10:104724152-104724174 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1073614053 10:104974872-104974894 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1073723473 10:106202501-106202523 CTCTCTTGCTGCTGCCATGTAGG + Intergenic
1074808927 10:117083212-117083234 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1075441784 10:122485616-122485638 CTCCCTTGTTGCTTTCCTGGTGG + Intronic
1076756081 10:132572447-132572469 CTGTGCTGGTGCTGTCCTGGGGG + Intronic
1077075391 11:698906-698928 GCCTCTGGGTGCTGTCCTGGAGG - Intronic
1077510774 11:2961013-2961035 CTCTCTAGGAGCTGCCTTGGTGG + Intronic
1077929731 11:6718560-6718582 ATCTGTTGGTTCTGTCCAGGAGG - Intergenic
1078744930 11:14103458-14103480 CTCCCTTGGTGATGTCAAGGAGG + Intronic
1079174471 11:18126368-18126390 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1079752752 11:24219055-24219077 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1080613689 11:33927339-33927361 GTCTCTTGCTTCTGTCGTGGAGG - Intergenic
1082744147 11:56944319-56944341 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1084422631 11:69067973-69067995 GTCTCCTGGTGCCGTCCTGCTGG + Intronic
1086331758 11:85761450-85761472 CTCTCCTCCTGCTCTCCTGGGGG - Intronic
1086495959 11:87404758-87404780 ATGGCTTGGTGCTGTCCTAGAGG - Intergenic
1087595016 11:100242638-100242660 CCCCCTTGGTGCTGTCGTGGTGG - Intronic
1089365365 11:117918065-117918087 CTCTCCTTGTGCTGTCCTGTGGG - Intronic
1090616353 11:128519029-128519051 CACTCCTGGTTCTCTCCTGGTGG - Intronic
1091327645 11:134703129-134703151 GGCTCTGGGTGGTGTCCTGGAGG + Intergenic
1092523871 12:9297841-9297863 CTCAGCTGGTGCTGTGCTGGGGG + Intergenic
1092543427 12:9434058-9434080 CTCAGCTGGTGCTGTGCTGGGGG - Intergenic
1093404441 12:18787170-18787192 CTCTTTTAGGGCTGGCCTGGTGG - Intergenic
1093730404 12:22559704-22559726 ATGTCTTGGTGCTGTCCTCATGG + Intergenic
1094318475 12:29158531-29158553 CTATTTTGGTGCAGTCCTGCCGG + Intronic
1094509519 12:31087998-31088020 CTCAGCTGGTGCTGTGCTGGGGG + Intronic
1095074006 12:37894345-37894367 CTCTTTCAGTGCTGGCCTGGTGG - Intergenic
1095083487 12:38033376-38033398 CTCTTTTTGGGCAGTCCTGGTGG - Intergenic
1096025951 12:48361125-48361147 ATATCTTGGTGCTGTCCTAGTGG + Intergenic
1096089544 12:48889774-48889796 CTTTCTTGTTGGTGTCCTTGAGG + Intergenic
1096780291 12:53987749-53987771 CTCTCTTGCCTCTGGCCTGGTGG - Intronic
1097774527 12:63630031-63630053 CTCTTTTAGGGCTGGCCTGGTGG - Intronic
1098767386 12:74507698-74507720 CTCTCTTAGGGCAGGCCTGGTGG + Intergenic
1099357890 12:81661012-81661034 CTCTTTTAGTGCAGGCCTGGTGG - Intronic
1099730200 12:86490388-86490410 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
1100465339 12:94839577-94839599 ATAGCTTGGTGCTGTCCTTGTGG - Intergenic
1100915925 12:99421851-99421873 ATGTCTTGGTGCTGTCCTCGTGG + Intronic
1101650977 12:106676724-106676746 CCCTCTTGGAGATGTTCTGGTGG - Intronic
1104844729 12:131841037-131841059 CTCGCTGGGTGCTGGCCTGTCGG + Intronic
1105063299 12:133173367-133173389 TCCCCTTGGTGCTGTCCTTGAGG + Intronic
1105072911 12:133246888-133246910 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
1105402642 13:20109506-20109528 CACTCTTGCTGCTGTGCTGAGGG - Intergenic
1106947216 13:34842121-34842143 TCCCCTTGGTGCTGTCCTTGTGG + Intergenic
1108031289 13:46232155-46232177 ATGGCTTGGTGCTGTCCTTGTGG - Intronic
1108680261 13:52774026-52774048 TCCTCTTGGTGCTGTTCTTGTGG - Intergenic
1109423574 13:62145118-62145140 ATAGCTTGGTGCTGTCCTTGTGG - Intergenic
1110529286 13:76577668-76577690 GTGTCTTAGTGCTGTCCTTGTGG + Intergenic
1112002138 13:95220780-95220802 CTCTTTTGGATCTCTCCTGGGGG - Intronic
1112584414 13:100705573-100705595 CTCTCAGAATGCTGTCCTGGGGG + Intergenic
1112799185 13:103092169-103092191 TTCTCTTGGTGTTCTCATGGTGG - Intergenic
1112922139 13:104627111-104627133 CTCTCTTGGTGCTATCTTAGAGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113826008 13:113254196-113254218 CTCTCGTGGGTCTGACCTGGAGG + Intronic
1113908851 13:113832403-113832425 CGATCCAGGTGCTGTCCTGGTGG + Exonic
1114431819 14:22667900-22667922 CTCTCTTGCTCCTGTTCTTGTGG - Intergenic
1114611443 14:24044019-24044041 ATGGCTTGGTGCTCTCCTGGTGG - Intergenic
1114665663 14:24375995-24376017 CCCTCTTGTTGCTGTACTCGGGG - Exonic
1117165471 14:53028452-53028474 ATGTCTTGGTGCTGTCCTTGAGG + Intergenic
1117191051 14:53292226-53292248 CTCTCTTGGTGCTGTGGTCATGG + Intergenic
1118066973 14:62203282-62203304 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1118250265 14:64153271-64153293 CTCTTTTGGTGCTCTCCTCCTGG - Intronic
1118903866 14:70008998-70009020 GTCTCTAGATGCTGTTCTGGTGG + Intronic
1120552952 14:85893546-85893568 CCCTCTTACTGCTATCCTGGGGG + Intergenic
1120586149 14:86314177-86314199 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1120598566 14:86472141-86472163 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1121221253 14:92287248-92287270 CTCTCTTGCTGCTGCCCTGTCGG + Intergenic
1121717208 14:96084802-96084824 CTAACATGGTGCTGTCCTTGAGG - Intronic
1122137634 14:99644190-99644212 GTCTCTTTGGACTGTCCTGGGGG - Intergenic
1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG + Intronic
1122817932 14:104322998-104323020 CCGCCTTGGTGCTGTCCTGGAGG - Intergenic
1122948948 14:105030101-105030123 ATCTCTGGGTGGTGCCCTGGTGG + Intergenic
1124497686 15:30196305-30196327 CTCGCATGGGGCTGTCTTGGGGG + Intergenic
1124708372 15:31984197-31984219 ATGGCTTGGTGCTGTCCTTGTGG + Intergenic
1124745900 15:32342386-32342408 CTCGCATGGGGCTGTCTTGGGGG - Intergenic
1125226887 15:37405580-37405602 TCCTCTTGATGCTGTCCTTGTGG - Intergenic
1127315399 15:57789821-57789843 CTTTCTTGGTCCTTTCCTAGGGG - Intergenic
1128357016 15:66935223-66935245 CTCTCTTGGACCTGTCAGGGTGG + Intergenic
1128416591 15:67452401-67452423 CTCTTTTAGGGCTGGCCTGGTGG + Intronic
1128563205 15:68682125-68682147 CCCTCTGTGGGCTGTCCTGGTGG - Intronic
1128958211 15:71972187-71972209 CTCTCTAAGTGCTGTCCTTTTGG - Intronic
1131274431 15:90969156-90969178 CTGTCCTGGTGCTCTCTTGGTGG - Intronic
1132981145 16:2739220-2739242 CTGTCCTGCTCCTGTCCTGGGGG + Intergenic
1133434375 16:5766641-5766663 ATGTCTTGGTGCTGTCCTCATGG - Intergenic
1133736547 16:8620231-8620253 CTCTCTGTGTACTGTCCTGGGGG + Intergenic
1134054588 16:11161718-11161740 CTCTCCCGTTGCTGTCCTGCAGG + Intronic
1135247202 16:20867229-20867251 CTCTCTAGATGCTTTGCTGGGGG - Intronic
1135874659 16:26187009-26187031 ATGTCTTGGTGCTGTCCTCTTGG + Intergenic
1135977304 16:27117148-27117170 ATGTCTTGGTGCCCTCCTGGTGG - Intergenic
1136678665 16:31939503-31939525 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic
1137472291 16:48772754-48772776 CTCTCTTAGGGCAGGCCTGGTGG + Intergenic
1137562990 16:49515002-49515024 CTTGCTTGGTCCTGTCATGGGGG - Intronic
1137700859 16:50496696-50496718 ATGGCTTGGTGCTGTCCTTGTGG + Intergenic
1138023842 16:53506741-53506763 CTTTCTTGGTGCAGACCTGTGGG - Intergenic
1138241776 16:55433344-55433366 CTCTCATGGTGCTGACTTGCTGG + Intronic
1139001191 16:62512094-62512116 ACATCTTGGTGCTGTCCTCGTGG - Intergenic
1140569880 16:76090905-76090927 CTCTCTTAGGGCAGGCCTGGTGG + Intergenic
1140941051 16:79722414-79722436 CTATCGTGGTGGTGTCATGGTGG + Intergenic
1142304692 16:89278721-89278743 CTCTCGTGAGGCCGTCCTGGTGG + Intronic
1142917196 17:3151552-3151574 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1142920259 17:3178360-3178382 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1142935138 17:3323534-3323556 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1142937611 17:3348996-3349018 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1143217264 17:5234327-5234349 CTGTCATGGTGCTATGCTGGAGG - Intronic
1144001273 17:11057411-11057433 GTGTCTTGGTGCTGTCCTCATGG + Intergenic
1144410997 17:15001670-15001692 ATGGCTTGGTGCTGTCCCGGCGG + Intergenic
1145290683 17:21543265-21543287 ATGGCTTGGTGCTGTCCTGGTGG - Intronic
1146264020 17:31439149-31439171 TGCTGTGGGTGCTGTCCTGGGGG - Intronic
1146550370 17:33775778-33775800 CACTCTCTGTGCTGTCCTTGGGG + Intronic
1146944390 17:36863979-36864001 CTGGCTTGGTGCTGTTCTAGAGG - Intergenic
1147266189 17:39236473-39236495 GTAGCTTGGTGCTGGCCTGGGGG - Intergenic
1147566805 17:41541442-41541464 CTCCATGGGTTCTGTCCTGGGGG - Intergenic
1148959436 17:51380860-51380882 GGCTCTTGCTCCTGTCCTGGAGG - Intergenic
1149394087 17:56221186-56221208 ATCTCTTGGTACTGTCCTCACGG - Intronic
1149853353 17:60055006-60055028 ATGGCTTGGTGCTGTCCTTGTGG + Intronic
1150463225 17:65370622-65370644 CTCTCTTGCTGATGTCCTGCTGG + Intergenic
1151704175 17:75758029-75758051 CTCACCGTGTGCTGTCCTGGGGG + Exonic
1151766483 17:76135878-76135900 CTCGCTTGGTCCTCTCCTGGAGG - Intergenic
1152594885 17:81233255-81233277 CTCTCTGGCTGCTGACGTGGGGG - Intronic
1154333931 18:13451318-13451340 GTGGCTTGGTGCTGTCCTTGAGG + Intronic
1155688108 18:28580638-28580660 TCCTCTTGGTGCTGTCCTCATGG - Intergenic
1158784590 18:60694525-60694547 GTCTCTTGGAGCTATCCTGTTGG + Intergenic
1159232814 18:65630693-65630715 TTCTCTTGCTGGTGTACTGGGGG + Intergenic
1160596577 18:79979464-79979486 TCCTCTTGGTGCTGTCCTCGGGG + Intronic
1161159681 19:2754990-2755012 CTCTCCGGCTGCTTTCCTGGTGG + Exonic
1161776195 19:6263571-6263593 CCCTCTTGGCGCTGTCTGGGGGG - Intronic
1164347516 19:27284719-27284741 CTCTTTTAGGGCTGGCCTGGTGG + Intergenic
1164992817 19:32696776-32696798 CTGTCTTGGAGCTGTCCTCAAGG - Intronic
1165851189 19:38851244-38851266 TTCTCTTGGTGCAGTGCGGGTGG - Intronic
1166265923 19:41684348-41684370 CTCTCCTGGTCCTTTCCTGATGG + Intronic
1166731055 19:45059254-45059276 TTCTCTTGGTGCAGACGTGGAGG + Exonic
1168704265 19:58459633-58459655 ATCTCTTGGTGCTGTCCTCAAGG + Intergenic
925062413 2:903448-903470 GTTTCTCGCTGCTGTCCTGGGGG + Intergenic
925837891 2:7963824-7963846 TCCTCTTGGTGCCGTTCTGGTGG - Intergenic
927939647 2:27095521-27095543 CTAACATGGTGCTGACCTGGGGG + Intronic
929158070 2:38805691-38805713 CTCTTTCTGTGCTGTCTTGGTGG - Intronic
930290836 2:49491029-49491051 CTCTCTGGTCACTGTCCTGGGGG + Intergenic
931477816 2:62607186-62607208 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
931590208 2:63874705-63874727 ATGGCTTGGTGCTGTCCTTGTGG + Intronic
931854901 2:66292794-66292816 TTCTCTTTTTGCTGCCCTGGAGG - Intergenic
935239263 2:101164174-101164196 ATGTCTTGGTGCTGTCCTCATGG + Intronic
937125237 2:119471055-119471077 CTCTCTCCCTGCTGTCCTGGTGG - Intronic
937410141 2:121667876-121667898 ATGGCTTGGTGCTGTCCTTGTGG - Intergenic
937905477 2:127050888-127050910 CTCTCTTCCTGCTGTCGTGGTGG - Exonic
937948068 2:127359694-127359716 CTCTAGTGCTGCTCTCCTGGTGG + Intronic
938694673 2:133824496-133824518 CTCTCTCCGTGCTGTTCTCGGGG - Intergenic
939178792 2:138780881-138780903 CTCTCTGGGCGCTCTCCAGGCGG - Intergenic
940836190 2:158524447-158524469 CTCTTTTAGGGCTGGCCTGGTGG - Intronic
941058447 2:160815742-160815764 ATGGCTTGGTGCTGTCCTCGTGG + Intergenic
941564125 2:167086119-167086141 CTCTTTTAGGGCTGGCCTGGTGG + Intronic
942443068 2:176056138-176056160 ATTACTTGGTGCTGTCCTGGTGG - Intergenic
942576817 2:177372673-177372695 ATGTCTTGGTGCTGTTCTTGAGG + Intronic
942744287 2:179213945-179213967 CTCTTTTGGGGCAGGCCTGGTGG - Intronic
942912629 2:181264308-181264330 CTTTCTAGGAGCAGTCCTGGGGG + Intergenic
944520820 2:200565238-200565260 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
944977035 2:205065613-205065635 GTGGCTTGGTGCTGTTCTGGTGG + Intronic
946334523 2:219028347-219028369 CTGGCTTGGTGCTGTCCGAGTGG + Exonic
946696994 2:222369609-222369631 CTCCCTTGGTACTGTCCTCATGG - Intergenic
947323184 2:228945635-228945657 GTCTCTTGGTTTTGTCCTCGGGG + Intronic
948075971 2:235165443-235165465 AGCTCTTGGTGCTGGCGTGGTGG - Intergenic
948626680 2:239273659-239273681 CTCTCTTTCTGGTGACCTGGCGG - Intronic
949018090 2:241724867-241724889 CTCTCCTGGTGCCCTCCTGCCGG + Intronic
949049667 2:241890822-241890844 GACTGTTGGTGCTGTCCTGGGGG - Intergenic
1169551040 20:6701443-6701465 CTCTCTTTCTTTTGTCCTGGGGG + Intergenic
1169918053 20:10703376-10703398 CCCCCTTGGTACTGTCCTTGTGG + Intergenic
1171075297 20:22116573-22116595 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1171146977 20:22793262-22793284 TCCTCTTGGTGCTGTCCTTGTGG + Intergenic
1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG + Intergenic
1171772304 20:29332424-29332446 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1172189785 20:33054979-33055001 CTCTCATCCTGCTGTCCTGGAGG + Intergenic
1172213989 20:33221530-33221552 TTTTCTTGGTACTGTCCTTGAGG + Intronic
1172329573 20:34065837-34065859 CTGTCTTGGTTCAGTCCTGCTGG - Intronic
1173968185 20:47129745-47129767 CTCTCTTGGTGATGGACTGAAGG + Intronic
1174801165 20:53564019-53564041 CCCTCTTGGGGCTGTCTTTGTGG - Intergenic
1176059865 20:63167855-63167877 CTTTCTTGCTGCTGCCCTTGGGG + Intergenic
1176387039 21:6143283-6143305 CTCTCTGGGTGCTGCCGTGAAGG + Intergenic
1177431517 21:20997418-20997440 CTCCCTCGGTGCACTCCTGGCGG + Intergenic
1178782039 21:35612778-35612800 CTTTCTTCGTGCTTTCCTGATGG - Intronic
1179736434 21:43394969-43394991 CTCTCTGGGTGCTGCCGTGAAGG - Intergenic
1180839440 22:18952294-18952316 GGCTCTGGGTGATGTCCTGGAGG + Intergenic
1180975520 22:19845768-19845790 CTCTCCTGGTGCAGGCCTCGGGG - Intronic
1181454924 22:23053713-23053735 CATTTTTGGTGCTGTCCAGGAGG - Intergenic
1182796125 22:32992977-32992999 TTCTTTTTGTGCAGTCCTGGTGG + Intronic
1183382469 22:37497019-37497041 CTCTCTTGGTTCCATCCTGGCGG + Exonic
1184377603 22:44124543-44124565 CTCCCTGGGGGCTGTCCTGGAGG + Intronic
949414359 3:3799732-3799754 CGGTCTTGGTGCTCTCCCGGGGG + Exonic
950150855 3:10686212-10686234 ATCTCTTGGTGCTTTTCTGTGGG - Intronic
950379582 3:12600191-12600213 CTCTCTTTGTGCTGGCACGGGGG + Exonic
951071015 3:18329459-18329481 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
951791662 3:26492286-26492308 CTCTCTTGGTCCTCACCTGCTGG - Intergenic
953108749 3:39911761-39911783 CTCTCTCTGTGCTGTGCTGGTGG + Intronic
953130794 3:40135848-40135870 CTCTTTTGGGGCAGGCCTGGTGG - Intronic
954890730 3:53925925-53925947 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
955652362 3:61208993-61209015 CTCTTTTAGGGCTGGCCTGGTGG + Intronic
958404090 3:93730205-93730227 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
958410070 3:93805564-93805586 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
958666941 3:97152932-97152954 CTATCATGATGCTTTCCTGGTGG + Intronic
958693291 3:97496086-97496108 CTCTCTTATTGCTTTCATGGTGG + Intronic
961043415 3:123693199-123693221 CTCTCTTGGTGACGTCCAGGGGG - Intronic
963993874 3:151684503-151684525 CTTTTTTGGAGCTGTCCTGGGGG + Intergenic
966058595 3:175727901-175727923 CTCTCTTGGGGCTGTCATGGTGG + Intronic
966777046 3:183552084-183552106 CTCTTTTGGTGATGCCGTGGGGG + Intronic
967547244 3:190745608-190745630 ATCACTTGGTGCTGTTCTGGAGG + Intergenic
967649458 3:191968181-191968203 CTCTCATGGTGACCTCCTGGAGG - Intergenic
968356487 3:198111574-198111596 CTCTGTTGGAGCTATGCTGGAGG + Intergenic
968705868 4:2077183-2077205 CCCTCCTGGTGCTGTGATGGAGG - Intronic
971945182 4:33266073-33266095 CTTTCTAGGTACTGTCCTTGTGG + Intergenic
973750229 4:54010020-54010042 CTTGCTTGGTGCTCTCCTGGTGG - Exonic
974238179 4:59208417-59208439 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
974253646 4:59421601-59421623 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
975731099 4:77337901-77337923 CTATCTGGTTGATGTCCTGGAGG + Intronic
975761004 4:77619659-77619681 CTCTCTTTGGTCTGTTCTGGAGG - Intergenic
976140562 4:81987118-81987140 CTTTCTTGCTTCTGTCCTGCAGG - Intronic
976411678 4:84720547-84720569 ATGGCTTGGTGTTGTCCTGGCGG + Intronic
976619536 4:87114463-87114485 CTCTCTGGGTGCCGCCGTGGGGG - Exonic
976706327 4:88023364-88023386 TCCTCTTGGTACTGTCCTTGAGG - Intronic
976899575 4:90157050-90157072 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
977109048 4:92927451-92927473 CTCTCTTTGTGCTACCCTGTGGG - Intronic
979487277 4:121283583-121283605 GTCTGTGGGTGCTGGCCTGGAGG - Intergenic
980231349 4:130050377-130050399 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
982210065 4:153027688-153027710 ATGGCTTGGTGCTGTCCTTGAGG - Intergenic
982337578 4:154257592-154257614 CTCTGTTGATGCAGTCCTGGGGG - Intronic
982554930 4:156848842-156848864 CTCTCTTGGTGTTAACCTGTGGG + Intronic
983589395 4:169391024-169391046 CTCTCTTGGTGCTATGCTATGGG + Intergenic
983669669 4:170221554-170221576 ATTGCTTGGTGCTGTCCTTGGGG + Intergenic
984756318 4:183328719-183328741 CTGTCCTGGTGATGTCCTGCTGG - Intergenic
984933578 4:184869925-184869947 CTCTCTTTGTGCTGCCCTATGGG - Intergenic
985171027 4:187150415-187150437 ATGTCTTGGTGCTGTCCTCCAGG - Intergenic
985608334 5:871271-871293 CCCGCTGGGTGCTGTCCTTGTGG - Intronic
985631457 5:1016135-1016157 AGCTCGTGGTGCTGGCCTGGAGG + Intronic
986530624 5:8732806-8732828 CTCTTTTAGTGCAGTCCTGGTGG - Intergenic
986568766 5:9143885-9143907 CTTTCTTGGCTTTGTCCTGGAGG - Intronic
986848495 5:11782947-11782969 CTCTTTTGGTGCTGGTCTAGTGG + Intronic
986916613 5:12627006-12627028 CTCTCTTGGTTCTGGCCCAGGGG + Intergenic
988262880 5:28911710-28911732 ATAGCTTGGTGCTGTCCTTGTGG + Intergenic
988492096 5:31713573-31713595 ATGGCTTGGTGCTGTCCTTGTGG + Intronic
989005010 5:36800516-36800538 ATGGCTTGGTGCTGTCCTCGTGG + Intergenic
989442736 5:41492111-41492133 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
989566195 5:42903845-42903867 TGTTCTTGGTCCTGTCCTGGTGG - Intergenic
989946164 5:50232056-50232078 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
990235743 5:53765427-53765449 CTAACTTGGAGCTTTCCTGGGGG + Intergenic
990684897 5:58289877-58289899 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
993879994 5:93350540-93350562 CTCTCTTCGTCTTGTCCTAGAGG - Intergenic
995257263 5:110061061-110061083 ATGGCTTGGTGCTGTCCTCGTGG + Intergenic
995668062 5:114567142-114567164 ATGGCTTGGTGCTGTCCTTGTGG - Intergenic
995686448 5:114777562-114777584 ATGTCTTGGTGCTGTCCTTGTGG - Intergenic
995699533 5:114918839-114918861 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
995726323 5:115184560-115184582 GTATCTTGGTGCTGTCCTCGTGG - Intergenic
996014777 5:118520943-118520965 CTGTCATGATGCTGTCCAGGAGG - Intergenic
996114331 5:119601275-119601297 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
996292017 5:121862600-121862622 ATCTCTTGGTGCAGTTTTGGAGG - Intergenic
996956076 5:129185251-129185273 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
997186957 5:131891892-131891914 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
997651839 5:135527621-135527643 ATATCTTGGTGCTGTCCTCATGG + Intergenic
998274758 5:140742022-140742044 TTGTATTGGTGCTGTCCTGTGGG - Intergenic
998833385 5:146182404-146182426 CTCTCCATGTGCTGTCCTGAAGG - Intronic
999049169 5:148503457-148503479 CTCTTTTAGGGCTGGCCTGGTGG - Intronic
999133420 5:149301304-149301326 CCCACTGGGTGCTCTCCTGGCGG + Intronic
999721167 5:154400271-154400293 CTCTCTTGGGACTGCCCTGCTGG + Intronic
1000268573 5:159661144-159661166 CTCTCTGGGTGGGGTCCTAGTGG - Intergenic
1001317745 5:170656442-170656464 CTCTCTGGGTTCTGTCCTTCAGG - Intronic
1001574850 5:172756663-172756685 ATGGCTTGGTGCTGTCCTCGGGG - Intergenic
1002015128 5:176315345-176315367 CTGTCTTGGTGCTGTCCTCATGG - Intronic
1002363068 5:178688672-178688694 ATGGCTTGGTGCTGTCCTTGAGG - Intergenic
1004453595 6:15770466-15770488 CTCACTAGGTGGTGTCCTTGAGG + Intergenic
1005388015 6:25305093-25305115 TTATCTTCCTGCTGTCCTGGTGG + Intronic
1006533281 6:34675903-34675925 CTTCCTTGTTGCTGGCCTGGTGG - Intronic
1006914298 6:37584769-37584791 GGCTCTTTGTGCTGTCATGGTGG - Intergenic
1006984818 6:38169339-38169361 GCCTCCTGGTGCTGCCCTGGTGG - Exonic
1007070994 6:39037984-39038006 TTCTCTTCCTCCTGTCCTGGAGG + Intergenic
1008367070 6:50693847-50693869 CTCTCTTGGTGCTGTTGTATGGG - Intergenic
1008873953 6:56305911-56305933 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1009059168 6:58376493-58376515 ATGTCTTGGTTCTGTCCTTGTGG - Intergenic
1009231678 6:61070636-61070658 ATATCTTGGTTCTGTCCTTGTGG + Intergenic
1009419461 6:63449203-63449225 CTCTTTCTCTGCTGTCCTGGTGG - Intergenic
1009984778 6:70769929-70769951 CTCTCTTAGGGCAGGCCTGGTGG + Intronic
1009986220 6:70784267-70784289 CTCTCTTAGGGCAGGCCTGGTGG - Intronic
1011364972 6:86571528-86571550 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
1011856858 6:91703807-91703829 CTATCTTGGTGCAGTTTTGGGGG - Intergenic
1011956852 6:93033969-93033991 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1014397594 6:120945210-120945232 CTCACTTGGTGCTGTCGTTGTGG - Intergenic
1016243630 6:141958938-141958960 ATGGCTTGGTGCTGTCCTTGTGG - Intergenic
1016603692 6:145892730-145892752 ATCTCTTGGAGCTGACCTAGGGG + Intronic
1016877065 6:148876259-148876281 CTGGCTTGGTGCTGTCCTTGTGG - Intronic
1017866470 6:158448111-158448133 CTCCTTTGCTGCTGTCATGGAGG + Intronic
1017969499 6:159299444-159299466 CTGACCTGGTGCTGTCCTGTGGG - Intergenic
1018340078 6:162842773-162842795 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1019100785 6:169627615-169627637 CTCCCTTGGTGCTGTGCACGGGG + Intronic
1021792800 7:24223326-24223348 CTAGCCTGGTGCTGTCCTTGGGG - Intergenic
1023189406 7:37563515-37563537 CCCACTAGGTGCTGTCCTGCAGG + Intergenic
1023907784 7:44534483-44534505 CTTTCCTGGTGCTGTCCGTGGGG - Exonic
1027819565 7:83025919-83025941 CTCTTTTAGTGCAGGCCTGGTGG - Intronic
1028079030 7:86550893-86550915 CTCTTTTAGGGCTGGCCTGGTGG - Intergenic
1029059274 7:97779839-97779861 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
1031579028 7:123449366-123449388 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1032106695 7:129037609-129037631 CTTTGGTGGTGCAGTCCTGGAGG + Intronic
1032445787 7:131982517-131982539 CTCTCTTAGGGCAGGCCTGGTGG + Intergenic
1033641299 7:143264939-143264961 TCCTCTTGCTGCTTTCCTGGTGG - Intronic
1033866258 7:145693358-145693380 TTCTGTTGTTGCTGTCGTGGTGG + Intergenic
1034341958 7:150363122-150363144 TTCTCTTGGTGCTCTCCAGCTGG + Intergenic
1034531470 7:151698473-151698495 ATGTCGTGGTGCTGTCCTCGTGG + Intronic
1035654200 8:1293251-1293273 CTCTCCTGGTGCAGTGCAGGGGG + Intergenic
1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG + Exonic
1039828722 8:41195796-41195818 CACTCATCGTGCTGTCTTGGGGG + Intergenic
1040086498 8:43348615-43348637 CTCTTTTAGGGCTGGCCTGGTGG + Intergenic
1040736227 8:50512092-50512114 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1040749742 8:50691425-50691447 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1040766634 8:50918938-50918960 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1040769465 8:50955702-50955724 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1040863774 8:52027292-52027314 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1044623887 8:94217570-94217592 CTCTCTTTCAGCTGTCCAGGAGG + Intergenic
1044946154 8:97391965-97391987 CTCTCTTCCTCCTGTGCTGGCGG + Intergenic
1044950786 8:97433655-97433677 ATGTCTTGGTGCTGTCCTTGTGG - Intergenic
1045601719 8:103724078-103724100 CTCTCTTGGCACTGTACTGCAGG + Intronic
1046675095 8:117099195-117099217 CAGTCTTGGTTCTGTCCTGAGGG + Intronic
1048355189 8:133647910-133647932 ATGTCTTGGTGCTGTCCTCTTGG + Intergenic
1049097478 8:140557617-140557639 CTTTCCTCGTCCTGTCCTGGGGG - Intronic
1051917366 9:22224506-22224528 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1054746564 9:68859645-68859667 GTCTGTTGGTGGTATCCTGGAGG + Intronic
1057287042 9:93765117-93765139 CTCTCTTTGTCCTTACCTGGTGG + Intergenic
1057438664 9:95065434-95065456 CCATCTTGGTGATGTCCAGGGGG + Intronic
1059688787 9:116663421-116663443 CTCTCTTACTGTTTTCCTGGGGG + Intronic
1061027162 9:128057151-128057173 CTTACCTGGTGCTGTCCTGTGGG + Intergenic
1061071805 9:128315517-128315539 CTCCCTTGGTCCTTTCCTGGGGG - Intronic
1061450525 9:130664815-130664837 CTGTCTTGGGGCTGGCGTGGTGG - Exonic
1203398019 Un_KI270519v1:45696-45718 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1186599509 X:11022149-11022171 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1186835756 X:13436169-13436191 CTTTCTTTGTGCTGTGCTGGAGG + Intergenic
1187645416 X:21341526-21341548 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic
1191589736 X:62869394-62869416 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1191707805 X:64112914-64112936 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1191748723 X:64517921-64517943 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1192761113 X:74097568-74097590 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1192826909 X:74706767-74706789 CTCTCTTCTTGCTCTACTGGAGG + Intergenic
1193050206 X:77091223-77091245 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1193054508 X:77136155-77136177 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1193289282 X:79753008-79753030 CTCTCTTGGGCCTATGCTGGTGG - Intergenic
1195157792 X:102141340-102141362 TTCTCTTTTTCCTGTCCTGGGGG + Exonic
1195249688 X:103031168-103031190 ATGTCTTGGTGCTGTCCTCATGG + Intergenic
1195989841 X:110671649-110671671 ATGGCTTGGTGCTGTCCTTGTGG - Intergenic
1196238872 X:113316817-113316839 CTTTCTTTGTGCTGAACTGGGGG - Intergenic
1196278895 X:113799664-113799686 ATGACTTGGTGCTGTCCTCGTGG + Intergenic
1196366624 X:114931682-114931704 CTCTCTTGGTGCTTTTCTAGTGG - Intergenic
1197019888 X:121674395-121674417 CTCTCTTGTTTTTGTCCTGAGGG + Intergenic
1197432657 X:126385096-126385118 CTCTTTTAGGGCTGGCCTGGTGG - Intergenic
1200274032 X:154715074-154715096 CACTCTTGTGCCTGTCCTGGAGG + Intronic
1201410377 Y:13693160-13693182 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
1201441625 Y:14014355-14014377 CTCTCTTAGGGCAGGCCTGGTGG - Intergenic
1201442945 Y:14028352-14028374 CTCTCTTAGGGCAGGCCTGGTGG + Intergenic
1202344207 Y:23904553-23904575 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1202526561 Y:25765530-25765552 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic