ID: 1036645480

View in Genome Browser
Species Human (GRCh38)
Location 8:10609375-10609397
Sequence CTCTCTTGGTGCTGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 352}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645471_1036645480 5 Left 1036645471 8:10609347-10609369 CCCGCCCGGCCCTGGAGCTTCTG 0: 1
1: 0
2: 6
3: 46
4: 392
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645476_1036645480 -4 Left 1036645476 8:10609356-10609378 CCCTGGAGCTTCTGGAGCTCTCT 0: 1
1: 0
2: 6
3: 27
4: 257
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645472_1036645480 4 Left 1036645472 8:10609348-10609370 CCGCCCGGCCCTGGAGCTTCTGG 0: 1
1: 0
2: 5
3: 34
4: 339
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645474_1036645480 1 Left 1036645474 8:10609351-10609373 CCCGGCCCTGGAGCTTCTGGAGC 0: 1
1: 0
2: 6
3: 40
4: 491
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645466_1036645480 19 Left 1036645466 8:10609333-10609355 CCAGCACCATCCTACCCGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645477_1036645480 -5 Left 1036645477 8:10609357-10609379 CCTGGAGCTTCTGGAGCTCTCTC 0: 1
1: 0
2: 6
3: 34
4: 299
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645465_1036645480 30 Left 1036645465 8:10609322-10609344 CCTTGGAGGCTCCAGCACCATCC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645468_1036645480 13 Left 1036645468 8:10609339-10609361 CCATCCTACCCGCCCGGCCCTGG 0: 1
1: 0
2: 1
3: 33
4: 380
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645475_1036645480 0 Left 1036645475 8:10609352-10609374 CCGGCCCTGGAGCTTCTGGAGCT 0: 1
1: 2
2: 2
3: 48
4: 407
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352
1036645470_1036645480 9 Left 1036645470 8:10609343-10609365 CCTACCCGCCCGGCCCTGGAGCT 0: 1
1: 0
2: 1
3: 33
4: 428
Right 1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 50
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645480 Original CRISPR CTCTCTTGGTGCTGTCCTGG AGG Exonic