ID: 1036645538

View in Genome Browser
Species Human (GRCh38)
Location 8:10609639-10609661
Sequence GCCGCCCGGAGCCACCATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645538_1036645541 1 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645541 8:10609663-10609685 TTTCCAAACCAGGCTCAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 115
1036645538_1036645545 23 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG 0: 1
1: 0
2: 6
3: 15
4: 155
1036645538_1036645542 2 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645542 8:10609664-10609686 TTCCAAACCAGGCTCAAGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 145
1036645538_1036645540 -9 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645540 8:10609653-10609675 CCGGGCGGCTTTTCCAAACCAGG 0: 1
1: 0
2: 0
3: 2
4: 56
1036645538_1036645547 30 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645547 8:10609692-10609714 CTCTGCCTCTCGCTGGCACTTGG 0: 1
1: 0
2: 2
3: 24
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645538 Original CRISPR GCCGCCCGGAGCCACCATGA TGG (reversed) Exonic
902917765 1:19648829-19648851 GCCTCACGGCGCCCCCATGAGGG + Intronic
905693620 1:39959983-39960005 TCTGCCAGGAGCCACCCTGAAGG - Intronic
905905916 1:41618462-41618484 GCTGCCAGGAGCCACAAGGATGG - Intronic
909992460 1:82239954-82239976 GCCGACTGGAGCCACAGTGATGG + Intergenic
912530465 1:110317308-110317330 ACTGCCCGGAGCCACCATCAAGG - Intergenic
920499302 1:206476420-206476442 GCCCCCCAGAGCCCCCATGAGGG + Intronic
921355504 1:214281239-214281261 GCGCCCCGCCGCCACCATGAGGG + Exonic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG + Intergenic
1084381621 11:68816529-68816551 GGCGGCCGGAGCCAGGATGAAGG - Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1089499902 11:118925769-118925791 GCCGCCCGGAGCCAGCCGGCCGG - Intronic
1090246917 11:125222983-125223005 GCAGCCTGGAACCACCAAGAAGG + Intronic
1091682254 12:2535420-2535442 GCAGGCGGGAGCCACCATGCCGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG + Intronic
1105332748 13:19433225-19433247 ACAGGCGGGAGCCACCATGATGG - Intronic
1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG + Intergenic
1105920898 13:24962496-24962518 ACAGGCGGGAGCCACCATGATGG - Intergenic
1106708983 13:32311413-32311435 GCCAGCCGCAGCCACCATCACGG - Exonic
1112321728 13:98414000-98414022 GCCAGCCAAAGCCACCATGAAGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG + Intronic
1123764689 15:23466482-23466504 GCAGGCCTGAGCCACCATGCAGG + Intergenic
1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG + Intergenic
1124545845 15:30626121-30626143 GACACCCGGAGCCACCACGGGGG - Intronic
1125892514 15:43276915-43276937 GCTGCTCAGAGCCACCATTAAGG + Exonic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133002813 16:2859696-2859718 GGCTCCCGAAGCCTCCATGAGGG - Intergenic
1133222175 16:4323485-4323507 GGGGCCCGGAGCCACCAGGATGG + Intronic
1133339437 16:5027160-5027182 GCCACCTGAAGCCACCCTGAGGG - Exonic
1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG + Intronic
1139589992 16:67928229-67928251 GCTCCCTGGAGGCACCATGAAGG - Exonic
1139666530 16:68460748-68460770 GAGACCAGGAGCCACCATGATGG - Intergenic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1145242600 17:21248561-21248583 ACCACCCGCAGCCCCCATGATGG + Intronic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG + Intergenic
1148769064 17:50056498-50056520 GCCGCCGGCCGCCACCATCAAGG - Exonic
1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG + Exonic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152538210 17:80962411-80962433 TCCTCCCGGAGGCCCCATGAGGG - Intronic
1152862862 17:82705852-82705874 GCCGGCGGGAGCCACCAGGACGG - Intergenic
1161510912 19:4670458-4670480 ACCGCCCGGGGCCACCATCTTGG + Intergenic
925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG + Intergenic
925969766 2:9098241-9098263 GCCTCCTGGACCCACCATCAGGG - Intergenic
930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG + Intergenic
931758330 2:65394345-65394367 GGCGCCAGCAGCCACCCTGATGG - Intronic
933460529 2:82577982-82578004 GGCGCCCGCCGCCACCATGCAGG - Intergenic
933695796 2:85216238-85216260 GCTGCCCGGAGCCACGGGGAAGG - Intronic
934710253 2:96509665-96509687 GCCGCCCTCAGCCACCAAGTCGG + Intergenic
946412889 2:219523883-219523905 GCTGCAGGGAGCCACCGTGATGG - Intronic
1171974776 20:31587654-31587676 GCCGCCCGGCACCACTAGGACGG - Intergenic
1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG + Intergenic
1172848478 20:37944364-37944386 GCCGCCTGTGGCCACCATGTCGG + Exonic
1176740275 21:10595317-10595339 ACAGGCGGGAGCCACCATGATGG + Intronic
1179919631 21:44500389-44500411 GCCGCCCAGAGCAAGAATGAGGG - Intronic
1183540090 22:38424816-38424838 GCTGCCCGGAGTCGCCATGAAGG + Intergenic
1184153003 22:42649309-42649331 GCGGCGCGGGGCCACCATGGGGG - Intronic
1184712804 22:46263064-46263086 GCCGCCCGGTCCCGCCATGGGGG + Exonic
1184749063 22:46473736-46473758 GCCACCAGGAGCCACCAAGCAGG - Intronic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG + Intergenic
953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG + Intronic
954945693 3:54422208-54422230 GCCGCTGGAAACCACCATGAGGG - Intronic
960875287 3:122289598-122289620 GCCGGGCAGAGCCAGCATGAAGG + Intergenic
965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG + Intergenic
965971481 3:174561474-174561496 ACCGCCATGAGCCACCATGCCGG + Intronic
966898719 3:184465136-184465158 GCAGCCCGGAGCCTCTATGGGGG - Intronic
969301550 4:6300201-6300223 ACCTCCCTGAGCCTCCATGAAGG - Intronic
970424422 4:15933186-15933208 GTGGCCAGGAGCCACCATTATGG - Intergenic
986600136 5:9464876-9464898 GCGGTCTGCAGCCACCATGAAGG + Intronic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1035751995 8:2002670-2002692 GCCGTCGAGAGCCACCATGTCGG - Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG + Exonic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1040829368 8:51660723-51660745 GTCTCCCTGAGCTACCATGAAGG + Intronic
1043092553 8:75924150-75924172 GCCAACCGGAGCCGCAATGATGG - Intergenic
1049746402 8:144265074-144265096 GCAGCCGGGGGCCACCATGTCGG + Intronic
1062173929 9:135150519-135150541 GCAGCCTGGACCCACCATGTGGG - Intergenic
1185449769 X:275936-275958 GTCTCCCGGAGCCCCCAGGACGG - Intergenic
1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG + Exonic
1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG + Intergenic