ID: 1036645541

View in Genome Browser
Species Human (GRCh38)
Location 8:10609663-10609685
Sequence TTTCCAAACCAGGCTCAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645531_1036645541 19 Left 1036645531 8:10609621-10609643 CCTGCGTGTGCTCTTGGCCCATC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1036645541 8:10609663-10609685 TTTCCAAACCAGGCTCAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 115
1036645536_1036645541 2 Left 1036645536 8:10609638-10609660 CCCATCATGGTGGCTCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1036645541 8:10609663-10609685 TTTCCAAACCAGGCTCAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 115
1036645538_1036645541 1 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645541 8:10609663-10609685 TTTCCAAACCAGGCTCAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645541 Original CRISPR TTTCCAAACCAGGCTCAAGC TGG Exonic
903326325 1:22570887-22570909 CTTCCACACCACGCTCACGCGGG - Intronic
903455311 1:23483551-23483573 TCTCCGAACCAGCCGCAAGCGGG + Intronic
903993676 1:27291176-27291198 TTTGCAAACTCTGCTCAAGCTGG - Intronic
904909823 1:33926338-33926360 TTACCAAACCACTATCAAGCAGG - Intronic
908993761 1:70127293-70127315 TTTCCAAACCATTCTCTTGCAGG - Intronic
915582685 1:156824488-156824510 CATTCAAACCAGGCGCAAGCTGG - Intronic
917318817 1:173758183-173758205 TTTACCTCCCAGGCTCAAGCGGG - Intronic
921186771 1:212677350-212677372 GTTCTCAACCAGGATCAAGCAGG - Intergenic
1064097173 10:12432371-12432393 TCTTCAAACCAGGCCCCAGCTGG - Intronic
1066006710 10:31152660-31152682 TTTGCAAATCAGACTGAAGCAGG - Intergenic
1066975692 10:42366332-42366354 TTTCCAAATATGGCTCAAGCAGG - Intergenic
1068513478 10:57995932-57995954 TATTCAGACCAGGCTCAATCTGG - Intergenic
1069638150 10:69937986-69938008 CTTCTGAACCAGGCTCAAGCAGG - Intronic
1073049731 10:100659904-100659926 CTTCCAAACCAGGGTCGGGCCGG - Intergenic
1073578452 10:104643058-104643080 TTTCCAAATCTGGCTCTAGTAGG - Intronic
1075946026 10:126433693-126433715 TTTTCAAACAAAGCTCATGCAGG - Intronic
1088196411 11:107278840-107278862 TTTCCACAGCAGGGTCATGCAGG + Intergenic
1088652890 11:111974080-111974102 ATTTCAAACCTGGCTCCAGCAGG + Exonic
1088863405 11:113822863-113822885 TTTCCATACCAGGCCTAAGATGG - Intronic
1089707782 11:120293000-120293022 TTTCCAGAGTAGGCACAAGCAGG + Intronic
1089863412 11:121610772-121610794 TTTAAGAACCAGGCTGAAGCTGG + Intronic
1091781663 12:3217764-3217786 TTTCCAGACCAGGCTAGAGAAGG - Intronic
1093762868 12:22929759-22929781 TTTCCTCTCCAGCCTCAAGCTGG + Intergenic
1095454685 12:42370695-42370717 CTTCCAAAACAGGCTGAAGGAGG - Intronic
1095808274 12:46344701-46344723 TTTCCAAACCATGCCCAATAGGG + Intergenic
1100493052 12:95099511-95099533 TTTCCAAGGGAGGATCAAGCTGG - Intronic
1103440860 12:120961854-120961876 TTTCCATGCCAGGCTGTAGCTGG + Intergenic
1104974315 12:132545668-132545690 GGGCCAACCCAGGCTCAAGCAGG + Intronic
1105996635 13:25678651-25678673 TTTCCAAACAAGGCTTTACCAGG - Intronic
1106985149 13:35338081-35338103 TTTCCAAAACAGGCTGAAGAAGG + Intronic
1107029758 13:35838818-35838840 TTTCCAAAGCAGGCAATAGCTGG + Intronic
1117236549 14:53783385-53783407 TTCCCAAACCATATTCAAGCAGG + Intergenic
1119165045 14:72485666-72485688 TTGCAGAACCAGGTTCAAGCTGG - Intronic
1121864884 14:97353423-97353445 TTTCTCATCAAGGCTCAAGCAGG + Intergenic
1123938439 15:25205220-25205242 TGCCCACACCAGGCTCAAGGAGG - Intergenic
1126087980 15:45026752-45026774 TTTCCAAAGCATTCTGAAGCAGG + Intronic
1127386246 15:58469547-58469569 TTTTCCAACCTGGCTCAGGCAGG + Intronic
1128317975 15:66673121-66673143 ATTCCAACGCATGCTCAAGCTGG - Intronic
1129379973 15:75158638-75158660 CTTCCCAGCCAGGCTCAGGCAGG + Intergenic
1129448871 15:75638333-75638355 TTTTCACACAAGGCCCAAGCTGG - Intergenic
1135822169 16:25693471-25693493 TTCCGAAACCAGGCTCTTGCGGG + Intronic
1136866883 16:33766466-33766488 TCTCCAGACCAGGCCCAGGCAGG + Intergenic
1138435963 16:57000240-57000262 TGTCCCAGCCAGGCTCAGGCTGG + Intronic
1138582311 16:57949553-57949575 TTTCCAACCAAGGCTCAACCTGG + Intronic
1140593259 16:76378019-76378041 TTTCTAATCCAGACTCCAGCAGG - Intronic
1203105279 16_KI270728v1_random:1349736-1349758 TCTCCAGACCAGGCCCAGGCAGG - Intergenic
1203128235 16_KI270728v1_random:1612632-1612654 TCTCCAGACCAGGCCCAGGCAGG + Intergenic
1147920976 17:43916987-43917009 TTGACACACCAAGCTCAAGCAGG + Intergenic
1149987222 17:61356422-61356444 TTTCCAAGTCAGGCTGAAGCTGG - Intronic
1152341445 17:79728148-79728170 TCTCCAGACCAGGCCCAGGCAGG + Intergenic
1152350262 17:79780250-79780272 TTTCCCAGCCAGGGTCAATCTGG + Intronic
1157807298 18:50667697-50667719 TTTCCAAACAAGGCTCCAGTTGG - Intronic
1159806436 18:72963148-72963170 ATTCAAAATCAGGCTTAAGCAGG + Intergenic
1160794824 19:940476-940498 TCTCCAAAACAGGCTCCAGAAGG - Intronic
1160902498 19:1435637-1435659 TATTCAAACCAGGGTCAAACTGG - Exonic
1162315478 19:9936093-9936115 CTTCAAATCCAGCCTCAAGCTGG - Intronic
1166291034 19:41863661-41863683 TTTCCAGACCACCCTCAAGAGGG - Intronic
1166390444 19:42406378-42406400 CTCCCAAACCAGGCTCAACAGGG - Exonic
926591942 2:14749790-14749812 TGTTCAAACCAGGCTGTAGCAGG + Intergenic
929525887 2:42702446-42702468 TTTACAAACCAGGCTTTAACAGG + Intronic
933573619 2:84041687-84041709 TTTCCTAAACAGGCTCTAGATGG - Intergenic
934860009 2:97756963-97756985 TTTGCAAAACAGACCCAAGCAGG - Exonic
934871476 2:97870471-97870493 TTTATAAACCAAGCTGAAGCAGG + Intronic
935339429 2:102046448-102046470 TTTCCAAATGTGGCTGAAGCTGG + Intergenic
935872310 2:107464196-107464218 TTACCAAACAAGACTTAAGCCGG - Intergenic
941317365 2:164009906-164009928 TTCCCAAATCAGGTTCAGGCTGG + Intergenic
948160042 2:235815906-235815928 TTTCAAAACCAGCCTGAAGGAGG - Intronic
948847129 2:240688436-240688458 TTCCCACACCTGGCTCAAGGTGG + Intergenic
1170405200 20:16028463-16028485 TTTCCAAACCATTCTCAAAGAGG + Intronic
1172014225 20:31863417-31863439 CATCCTATCCAGGCTCAAGCTGG - Intronic
1172100371 20:32481671-32481693 TGTCTAATCCAGGCTCAGGCTGG - Intronic
1172636658 20:36414600-36414622 TTTGCTAACTGGGCTCAAGCAGG - Intronic
1173782664 20:45769647-45769669 CTTCCAAACAAGACTCAAGGAGG + Intronic
1174203679 20:48824665-48824687 TTTACAAATAAGGCTCAAACAGG + Intronic
1175621081 20:60448173-60448195 ATTACACACCAGGCTCAAGCTGG - Intergenic
1177686503 21:24443987-24444009 TTCCCACACCAGGGTCAAGAAGG + Intergenic
1181427147 22:22851059-22851081 TTTCTAACCCAGGATAAAGCTGG + Intronic
1182906722 22:33944167-33944189 TTTCTAAACCAGTGTCCAGCAGG - Intergenic
1183682814 22:39343677-39343699 CTGCCAAACCAGCCTCAAGAGGG + Intergenic
952539887 3:34356901-34356923 TTTCCACACCAGGCAGAAACAGG - Intergenic
953260051 3:41329291-41329313 TTTCCAAATTTGGCTCAATCTGG + Intronic
954732848 3:52679613-52679635 TGTCAACACCAGGCCCAAGCAGG - Exonic
955206831 3:56903647-56903669 TATCCAAACAAGGGTCAGGCAGG - Intronic
956637816 3:71383731-71383753 CTTCCAAACCAGGTTCAAGGGGG - Intronic
957026734 3:75190932-75190954 TTTCCAAAGCTGACTCAAGGCGG - Intergenic
959501364 3:107109165-107109187 TTTACAAACATGGCTCAAACAGG + Intergenic
963295495 3:143541646-143541668 TTTCCAACCCAGGGTCAACCTGG - Intronic
965638687 3:170810666-170810688 GTTCCAAACCAGGCTCTACTTGG + Intronic
968744840 4:2354212-2354234 TTTCCACACCAGGATCTAGAGGG + Intronic
971871941 4:32252201-32252223 ATTCCCTTCCAGGCTCAAGCAGG - Intergenic
972559387 4:40213401-40213423 TTTACAAACCTGGCCCAAGATGG - Intronic
974262351 4:59542091-59542113 ATACAAGACCAGGCTCAAGCAGG - Intergenic
974498029 4:62658392-62658414 TTTAGAAACCAGTCTCAAGAAGG + Intergenic
975527907 4:75371402-75371424 TTTCCAAAGAAGGCTGAACCAGG - Intergenic
982086425 4:151841181-151841203 TTTCCTCACCAGGCTGGAGCTGG - Intergenic
982399110 4:154946365-154946387 TTTCCATGTCAGGCTCCAGCAGG + Intergenic
982574836 4:157096504-157096526 TTTCCAAACAATGGTCAAGAGGG + Intronic
983987058 4:174072717-174072739 TTTAAAAATCAGGCTCAGGCTGG + Intergenic
988885289 5:35550572-35550594 TCTTCAAACCAGTCTCCAGCAGG + Intergenic
991463325 5:66882754-66882776 TATCCAAACCTAGCTCAAGCAGG + Intronic
997732586 5:136192136-136192158 CCTCCCTACCAGGCTCAAGCTGG + Intergenic
1002025033 5:176391027-176391049 TTTCAACACCAGCTTCAAGCTGG + Intronic
1003351739 6:5324287-5324309 ATTCCCAACCAGTTTCAAGCAGG - Intronic
1005256681 6:24010957-24010979 TTTTCAAACCTGGCATAAGCAGG - Intergenic
1005366809 6:25086806-25086828 ATTCCAAACACGGCTCCAGCGGG - Intergenic
1006863984 6:37193509-37193531 TTTCCAACCCAGGCTGAGGCGGG - Intergenic
1012841834 6:104338732-104338754 TTTCCAAATCAGGCTTAACCAGG - Intergenic
1013294877 6:108750021-108750043 TATCCAACCTAGGCTCAAACTGG - Intergenic
1014824203 6:126030163-126030185 TTTCCAAACCAAGGACAAGCAGG - Intronic
1015013451 6:128380057-128380079 TTTCCAAACCCTGCTCAGCCTGG + Intronic
1015822559 6:137280029-137280051 TTTCCACACCAGTATCATGCTGG + Intergenic
1016974249 6:149791239-149791261 TTTAGAAACCAGGCTCATTCTGG - Intronic
1019900868 7:4019873-4019895 TTTCCACACCAGGCTTAAAAGGG - Intronic
1029645632 7:101853989-101854011 TTTCCAGACAAGCCTCAAGATGG - Intronic
1035845448 8:2859423-2859445 CTTCCATAACAGGCTCAGGCAGG + Intergenic
1036116446 8:5965552-5965574 TTTCCAAGACAGCCTCAAGATGG + Intergenic
1036526169 8:9536877-9536899 TTTCTAAAGCAGGCTCAAGCTGG - Intergenic
1036610026 8:10341649-10341671 TTACCTATCCAGGCTCAAACAGG - Intronic
1036645541 8:10609663-10609685 TTTCCAAACCAGGCTCAAGCTGG + Exonic
1052008253 9:23376235-23376257 TTTCAAAACCAGTTTCAAACGGG + Intergenic
1052325035 9:27208578-27208600 TTTACAAACCAGTCTCAATCTGG - Intronic
1053006780 9:34610282-34610304 TTCCTAAACCAGGCCAAAGCAGG + Intergenic
1056062844 9:82901876-82901898 TTTCACAACCAGGACCAAGCTGG + Intergenic
1059400076 9:114063469-114063491 CTTCCAGACCAGTCTTAAGCTGG + Intronic
1059661892 9:116409650-116409672 TTTCCATGCAAGGCTCAAACAGG - Intergenic
1186481656 X:9900907-9900929 TCCCCAAAGCAGGCTCCAGCTGG - Intronic
1188467388 X:30497432-30497454 TTTCAAAACCAGGCTTAATTGGG + Intergenic
1188953207 X:36402210-36402232 TTTCCAAACCATGCTTCAGATGG - Intergenic
1192265669 X:69535969-69535991 TTTCTAAACAATGCTGAAGCTGG - Intergenic
1201441121 Y:14009360-14009382 CTTCCAAACCAGGGACATGCAGG - Intergenic
1201443450 Y:14033348-14033370 CTTCCAAACCAGGGACATGCAGG + Intergenic