ID: 1036645545

View in Genome Browser
Species Human (GRCh38)
Location 8:10609685-10609707
Sequence GGAGCCACTCTGCCTCTCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645536_1036645545 24 Left 1036645536 8:10609638-10609660 CCCATCATGGTGGCTCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG 0: 1
1: 0
2: 6
3: 15
4: 155
1036645538_1036645545 23 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG 0: 1
1: 0
2: 6
3: 15
4: 155
1036645539_1036645545 9 Left 1036645539 8:10609653-10609675 CCGGGCGGCTTTTCCAAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG 0: 1
1: 0
2: 6
3: 15
4: 155
1036645543_1036645545 -4 Left 1036645543 8:10609666-10609688 CCAAACCAGGCTCAAGCTGGGAG 0: 1
1: 0
2: 0
3: 21
4: 138
Right 1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG 0: 1
1: 0
2: 6
3: 15
4: 155
1036645544_1036645545 -9 Left 1036645544 8:10609671-10609693 CCAGGCTCAAGCTGGGAGCCACT 0: 1
1: 0
2: 3
3: 16
4: 184
Right 1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG 0: 1
1: 0
2: 6
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645545 Original CRISPR GGAGCCACTCTGCCTCTCGC TGG Exonic
900137258 1:1122797-1122819 CCAGCCCCTCTGCCTCACGCGGG + Intergenic
900408499 1:2502676-2502698 GGGGCCTCTCTGCTTCTCCCCGG - Intronic
900525823 1:3128098-3128120 GGATCAACTCCGCCTCTCACTGG + Intronic
901744549 1:11363804-11363826 GGAGCCACTCCGCCCTTCTCAGG - Intergenic
903593761 1:24478512-24478534 TGAGCCACTCTGCCTAGCCCAGG + Intergenic
907405080 1:54248949-54248971 TGAGCCTCTCTCCCTCCCGCTGG + Intronic
907908463 1:58806574-58806596 GCAGTAACTATGCCTCTCGCTGG - Intergenic
908758301 1:67489308-67489330 AGAGCCACTGTGCCTCGCCCAGG - Intergenic
909585297 1:77282135-77282157 GGACCCCCTCCGCCTCTCCCCGG - Exonic
910217083 1:84853663-84853685 GGACCAGCTCTGCCTCTCTCTGG + Intronic
910464121 1:87478277-87478299 GGAGTCACTCTGCCTTTGGAAGG - Intergenic
912191728 1:107348407-107348429 TGAGCCACTGTGCCTGTCCCTGG + Intronic
914877731 1:151524838-151524860 GGAGCTGCTCTGTGTCTCGCTGG - Exonic
915981115 1:160420414-160420436 GGATCCACACTGCCACGCGCTGG - Exonic
920850250 1:209623606-209623628 CCAGCCTCTCTGCCTCTCTCCGG + Exonic
922701961 1:227766397-227766419 GGAGCGAGACTGCCTCTGGCAGG + Intronic
922799057 1:228355908-228355930 GGACCCACTGTCCCTCTCGAGGG - Intronic
922917628 1:229271313-229271335 GGAGCGGCGCCGCCTCTCGCCGG - Exonic
924501928 1:244645992-244646014 GGAGCCACTGTGGCTCTCATAGG - Intergenic
1063280531 10:4624889-4624911 TGAGCCCCTCTTCCTCTCACTGG + Intergenic
1064701288 10:18024068-18024090 GTAGCCACTCTGCATTTCTCTGG - Intronic
1065102023 10:22340774-22340796 GGAGCCGCACTGCCGCTCGGGGG - Intergenic
1066204883 10:33179267-33179289 CGACCCACTCTGCTTCTTGCTGG - Exonic
1069681964 10:70291776-70291798 GGAGACAGTCTATCTCTCGCTGG + Intergenic
1073533453 10:104254183-104254205 GGAGTCATCCTTCCTCTCGCTGG - Intronic
1073568295 10:104554518-104554540 GGAGGCACTCTTCATCTCTCAGG - Intergenic
1076874902 10:133211149-133211171 GGAGGGGCTCTGCCTCTCTCTGG + Intronic
1077044805 11:540074-540096 GAAGCCACTCTGACTCTTGCAGG + Intronic
1080340742 11:31260705-31260727 GGAGTCACTCTCCCTCTCAAGGG - Intronic
1083151377 11:60793852-60793874 GGAGAGACTCTGCCTGTCACTGG - Intronic
1087896387 11:103590925-103590947 GGACCCAATCTGCCTCTTTCAGG + Intergenic
1089055546 11:115581956-115581978 GGAGCCAATCTGCGTTTCACTGG - Intergenic
1089167225 11:116486463-116486485 GGTGCCACTGGGCCTCTGGCTGG - Intergenic
1090273527 11:125404192-125404214 TGAGCCACACTGCCTGTCACAGG + Intronic
1093607761 12:21113482-21113504 GGAGCCATTGTGGCTCTGGCCGG - Intronic
1096520815 12:52183577-52183599 TGAGCCTCTCTTCCTCTCTCTGG - Intronic
1096772560 12:53945378-53945400 GGAGCCTCTCTGCCTCCGGGCGG - Exonic
1097864777 12:64550793-64550815 GGAGTCTCTCTCCCTCTCTCAGG - Intergenic
1100365722 12:93918610-93918632 AGAGCCACACTGCCTTTCTCGGG + Intergenic
1104108283 12:125683849-125683871 GGAGCCACTCTGCCAACCCCTGG - Intergenic
1104270851 12:127280984-127281006 GGAGCCACTCTGCCAACCCCTGG + Intergenic
1104948767 12:132429371-132429393 GCGGCCACTCTCCCTCTCCCAGG + Intergenic
1105779003 13:23690189-23690211 GGTGCCACTCTGTGTCTGGCAGG - Intergenic
1108314076 13:49220952-49220974 GCCGCCTCTCTGGCTCTCGCGGG + Exonic
1110743079 13:79019696-79019718 GGAGGCGCTCTGCCTCTCTCAGG + Intergenic
1110993188 13:82069882-82069904 GGAGGCTCTCTGCCTCACTCAGG + Intergenic
1113485859 13:110651983-110652005 GGAGCCACTCGGGCTCCCGTCGG - Intronic
1113708005 13:112446570-112446592 GAAGCCGCACTGCCTCTCCCAGG + Intergenic
1114443469 14:22769837-22769859 GGATCCTGGCTGCCTCTCGCTGG - Exonic
1115562842 14:34598733-34598755 GGAGCCACTGTGCCTGGCTCAGG - Intronic
1116053631 14:39836348-39836370 GGAGCCACACTGCCTATAACTGG - Intergenic
1117254503 14:53964037-53964059 GGAGCCGCTCTGCCGCTGCCAGG - Intergenic
1118666533 14:68075946-68075968 GTAGCAACTCTGCATCTCTCAGG - Intronic
1121457288 14:94046571-94046593 GGGGCCCCTCTACCTCTCTCAGG + Exonic
1122695702 14:103551098-103551120 GCATCCACTCAGCCTCTCCCTGG - Intergenic
1125009707 15:34857780-34857802 GGCTCCTCTCTGCCTCTCACAGG - Intronic
1127380477 15:58426767-58426789 GGAGCCATTCTGTCTCTCTAAGG + Intronic
1129457076 15:75681830-75681852 GGATCCACTCTGCCTCTGGCTGG + Intronic
1129726709 15:77905110-77905132 GGATCCACTCTGCCTCTGGCTGG - Intergenic
1130274742 15:82470450-82470472 GGATCCACTCTTCCTCTGGCTGG - Intergenic
1130467087 15:84197824-84197846 GGATCCACTCTTCCTCTGGCTGG - Intergenic
1130486515 15:84401353-84401375 GGATCCACTCTGCCTCTGGCTGG + Intergenic
1130497177 15:84475712-84475734 GGATCCACTCTTCCTCTGGCTGG + Intergenic
1130589386 15:85202417-85202439 GGATCCACTCTTCCTCTGGCTGG - Intergenic
1130809581 15:87362748-87362770 GAAGTCACTCTGCTTCTCACTGG - Intergenic
1130895643 15:88168628-88168650 GGAGCCCCACTGCCTCCTGCAGG + Intronic
1131585020 15:93683914-93683936 GGAGACAGTCTGCCTCTCTCTGG - Intergenic
1131747832 15:95468986-95469008 GGAGCAGCTCAGGCTCTCGCCGG - Intergenic
1133074337 16:3268363-3268385 GGAGCCACTGTGCCTGTCCAAGG + Intronic
1134069717 16:11253604-11253626 GGAGCCACTCTTCCCTTCCCTGG + Intronic
1137861797 16:51854466-51854488 GGAGCCACTCTGCACTTCCCTGG + Intergenic
1138520416 16:57567849-57567871 GGAGTCACTCTGCTTCCTGCAGG - Exonic
1141846653 16:86613816-86613838 GGAGCCACCGTGCCTCCCTCAGG + Intergenic
1142257256 16:89020006-89020028 GGAGCCCCTCTTCCTCCCACTGG + Intergenic
1142284878 16:89167624-89167646 GGAGCCACACTGCCCCCTGCCGG + Intergenic
1142778794 17:2164131-2164153 TGAGCCACTGTGCCCCTCTCTGG - Intronic
1143038763 17:4016880-4016902 GGAGCCACCCTGCCTCTACTAGG - Intronic
1145783177 17:27577418-27577440 GGAGCCCCTCAGCCTCAGGCTGG - Intronic
1146359136 17:32159819-32159841 GGAGCCTGTCTGCCTCCTGCTGG - Intronic
1148067912 17:44886584-44886606 GAAGACACTCAGCCTCTCACAGG - Exonic
1150249430 17:63698011-63698033 GGAGCCACCCTGCCTCTGCAGGG - Exonic
1150694090 17:67389331-67389353 GGGGCCATTCTGCCTCTCCTAGG + Intronic
1150917680 17:69453063-69453085 GGAGACACTTTGCCTTTTGCTGG + Intronic
1151108940 17:71652771-71652793 TGAGCCACTGTGCCTGACGCTGG - Intergenic
1151562547 17:74878293-74878315 GCAGCCACCCTGCCCCTCCCTGG - Exonic
1156370932 18:36470690-36470712 GTAGCCACTCTGCCTCTGGGGGG + Intronic
1156800656 18:41109359-41109381 GGAGCCAGTCTGTCTCTCATGGG + Intergenic
1157900735 18:51514202-51514224 TGAGCCACTCTGCCTCTAGCTGG - Intergenic
1160780459 19:875658-875680 GGAGCGGCTCTGCCTCTGGTGGG + Intronic
1163225494 19:15957859-15957881 GAAGGCACTTTGCCTCTCACAGG + Intergenic
1163827988 19:19534608-19534630 GGGGCCTCTCTGTCTCTCTCTGG - Intronic
1166017828 19:39996655-39996677 GGAACCTCTCTGGCTCTGGCGGG - Intronic
1167158453 19:47753088-47753110 GGAGCCACTGTGCATTTAGCGGG + Intronic
1167547908 19:50140296-50140318 GGAGCCACTGTGGCTCCGGCTGG - Intergenic
927653288 2:24925079-24925101 GGAGCCTCCCTGACTCTCACAGG + Intergenic
929276523 2:40031916-40031938 TGAGCCACTGTGCCTCTCCAAGG - Intergenic
932702205 2:73999805-73999827 AGGGCCACTCTGCCTCCAGCCGG - Intronic
933078161 2:77955002-77955024 GGAGCCACTGTGGCTCCGGCCGG - Intergenic
934853904 2:97717403-97717425 GGAGCCTCTGAGCCTCTGGCTGG + Intronic
934853919 2:97717461-97717483 GGAGCCTCTGAGCCTCTGGCTGG + Intronic
937856839 2:126678483-126678505 AGAGCCAGTGTGCCTCTGGCCGG + Intronic
938260549 2:129892437-129892459 GTGTCCACTCTGCCTCTCCCTGG - Intergenic
938792716 2:134691063-134691085 GGAGGCACTCTGCCAATCACTGG + Intronic
940305261 2:152218607-152218629 TGAGCCACTGTGCCTGTCCCAGG + Intergenic
944833483 2:203555909-203555931 TGAGCCACTGTGCCTGTCCCAGG + Intergenic
945772520 2:214062134-214062156 TGAGCCACTCTGCCTGGCCCAGG - Intronic
947353272 2:229268755-229268777 GAAGCCACTTTGCCACTCCCAGG - Intronic
948645496 2:239401302-239401324 GGAGCCTCTCTGCCGCTCATAGG - Intronic
948786092 2:240353686-240353708 GGAGCCCCTCAGCCTCTGGGCGG - Intergenic
1173965402 20:47108871-47108893 GGAGCCCCTCTGGCTCTCCCCGG + Intronic
1174269289 20:49355327-49355349 TGAGCCACTGTGCCTGGCGCCGG + Intergenic
1174353400 20:49983377-49983399 GGAGCTCCTCCGCCTCTCGCCGG - Intronic
1175722584 20:61296076-61296098 GAAGCCGCTCTCCTTCTCGCAGG - Intronic
1176304355 21:5115462-5115484 AGAGCCTCTCAGCCTCCCGCAGG - Intergenic
1177708336 21:24738239-24738261 GGAGCCATTGTGGCTCTGGCCGG + Intergenic
1178418652 21:32425465-32425487 GGAGCCACTGTGCCTGGCCCAGG + Intronic
1180043498 21:45292366-45292388 GGCGCCCCTCTGCCTCTCCGTGG + Intergenic
1180092700 21:45541280-45541302 GGAGCCAGGCTGCATCTCACTGG - Intronic
1181114490 22:20622674-20622696 GGAAGCACCCTGCCTCTCTCGGG + Intergenic
1183466684 22:37983709-37983731 GGAGCCCCGCTGCCTGTCCCCGG - Exonic
1183986979 22:41575401-41575423 GGAGCCTCTCAGCCTCTGGCAGG + Exonic
1184869456 22:47226046-47226068 GGAGCCTGTCTGCCTCCTGCTGG + Intergenic
1185032230 22:48450203-48450225 TGGGCCACTCTGCCTCTTCCTGG + Intergenic
952740103 3:36726517-36726539 AGAGGAACTCTGCCTCTCCCTGG + Intronic
954665406 3:52248760-52248782 GGAGCTCCTTTGCCTCTTGCTGG + Intronic
954877442 3:53811410-53811432 AGAGCCAGTCTGCCCCTCGCTGG - Exonic
955449669 3:59052157-59052179 TGAGCCACTCTGCCTATAGCAGG - Intergenic
960986311 3:123283347-123283369 GGCACCACACTGCCTGTCGCAGG + Exonic
961110733 3:124281100-124281122 GGAGGAAATCTGCCTCTAGCTGG + Intronic
963228728 3:142888854-142888876 GGCGCCACTCTGCCTGCTGCTGG - Exonic
967291152 3:187921501-187921523 GGAGCCAGGCTGCCTCTGGATGG - Intergenic
967853345 3:194098394-194098416 TGGGTCACTCTGCCTCTCACTGG + Intergenic
968309992 3:197675314-197675336 GGTGCCACTCAGCACCTCGCGGG - Intronic
968552914 4:1233193-1233215 GGAGCCCCTCGGTCTCTTGCTGG - Intronic
969249440 4:5957299-5957321 GGCACCACGCTGCATCTCGCTGG + Exonic
970280380 4:14448474-14448496 GGGGCCAATATGCCTCTCACAGG - Intergenic
985924458 5:3004919-3004941 GGAGCCAGTTTGCTTCTCCCTGG - Intergenic
987597377 5:20019475-20019497 GGGGCCAATTTGCCTCTTGCTGG + Intronic
987926716 5:24351150-24351172 GAAGCCCCGCTGCCTCTGGCTGG + Intergenic
998504364 5:142660272-142660294 GGAGCCACTCAGCCTCTGACTGG + Intronic
999408322 5:151326588-151326610 GAGGCCAGTCTGCCTCTTGCCGG + Intronic
1001387722 5:171353646-171353668 GGAGCCACCCTGCCTGGCCCAGG - Intergenic
1002426700 5:179180951-179180973 AGAACCACCCTGCCTCTCCCTGG - Intronic
1003623986 6:7726694-7726716 GGAGCCTCACAGCCTCGCGCAGG - Intergenic
1006098791 6:31672810-31672832 GGAACCACTGTGCCTTTCTCAGG - Exonic
1008627704 6:53334322-53334344 GGAGCCTCTCTGGCTCTGGTTGG - Intronic
1015965454 6:138692668-138692690 CGCGCCACTCTTCCGCTCGCTGG - Intergenic
1016320551 6:142839936-142839958 AGAGCCACTGTGCCTCTCATAGG + Intronic
1021649882 7:22822705-22822727 GGAGCCAGTTTGCCATTCGCTGG - Exonic
1023480143 7:40625396-40625418 GAAGCCACTCTGCCACTGGAAGG + Intronic
1023909344 7:44542308-44542330 GGAGCCACCCAGCCTCATGCAGG + Intergenic
1026972039 7:74474349-74474371 GAAACCCCTCTGCCTCTAGCAGG + Intronic
1033727016 7:144129733-144129755 GGGGCCACTCTGCCTGGTGCTGG + Exonic
1034429399 7:151033706-151033728 GGAGCCCCTCTGCCTGGTGCTGG + Exonic
1034943548 7:155247856-155247878 TGAGCCCCTCAGCCCCTCGCTGG - Intergenic
1036593625 8:10192353-10192375 GGATCCACTCTACCGCTCACTGG - Intronic
1036645545 8:10609685-10609707 GGAGCCACTCTGCCTCTCGCTGG + Exonic
1039265139 8:35815998-35816020 GCAGCCTCTCTGGCTCTGGCAGG - Intergenic
1039870218 8:41539731-41539753 GGAGCCTTCCAGCCTCTCGCCGG + Exonic
1040535057 8:48301850-48301872 GAAGAGACTCTGCCTCTCGATGG + Intergenic
1040618144 8:49060996-49061018 GGAGAGTTTCTGCCTCTCGCTGG - Intronic
1047436481 8:124839319-124839341 GCAGCCAGCCTGCCTCTCCCTGG + Intergenic
1047454226 8:124994472-124994494 GGTGCCACTCTGGCTCTCCTAGG - Intergenic
1048287279 8:133151684-133151706 GAAGTCACTCTGCCTCTCAGAGG + Intergenic
1048473481 8:134723312-134723334 GGATGCCCTCTGCCTCCCGCTGG - Intergenic
1049300737 8:141868071-141868093 GGTGCCAGCCTGCCTCTCACAGG + Intergenic
1050361009 9:4831088-4831110 GGACCTACTCTGCCTCTCACTGG - Intronic
1055079697 9:72257203-72257225 GGGGCTACTCTGTCTGTCGCGGG - Intergenic
1058871652 9:109207080-109207102 GGGGCCACTGTGCCTGGCGCTGG - Intronic
1060344001 9:122800917-122800939 GGCCCCACTCTGCCTCGCGTCGG - Exonic
1060521806 9:124298253-124298275 GGACCCTCTCTGGCTCTCGGTGG + Intronic
1062247116 9:135574933-135574955 GTAGCGACTCTGGCTCTCTCTGG - Intergenic
1191674967 X:63784579-63784601 AGAGCCACTCTCTCTCTCTCAGG - Intronic
1191930316 X:66365114-66365136 GGTGGCAGTCTGCCTCTCTCTGG + Intergenic
1198312342 X:135435119-135435141 GGACCTCCTCTGCCACTCGCAGG - Intergenic
1202369049 Y:24185204-24185226 GGATCCACTCTGCCTCTGGCTGG + Intergenic
1202501736 Y:25484913-25484935 GGATCCACTCTGCCTCTGGCTGG - Intergenic