ID: 1036645547

View in Genome Browser
Species Human (GRCh38)
Location 8:10609692-10609714
Sequence CTCTGCCTCTCGCTGGCACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645539_1036645547 16 Left 1036645539 8:10609653-10609675 CCGGGCGGCTTTTCCAAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1036645547 8:10609692-10609714 CTCTGCCTCTCGCTGGCACTTGG 0: 1
1: 0
2: 2
3: 24
4: 291
1036645543_1036645547 3 Left 1036645543 8:10609666-10609688 CCAAACCAGGCTCAAGCTGGGAG 0: 1
1: 0
2: 0
3: 21
4: 138
Right 1036645547 8:10609692-10609714 CTCTGCCTCTCGCTGGCACTTGG 0: 1
1: 0
2: 2
3: 24
4: 291
1036645538_1036645547 30 Left 1036645538 8:10609639-10609661 CCATCATGGTGGCTCCGGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1036645547 8:10609692-10609714 CTCTGCCTCTCGCTGGCACTTGG 0: 1
1: 0
2: 2
3: 24
4: 291
1036645544_1036645547 -2 Left 1036645544 8:10609671-10609693 CCAGGCTCAAGCTGGGAGCCACT 0: 1
1: 0
2: 3
3: 16
4: 184
Right 1036645547 8:10609692-10609714 CTCTGCCTCTCGCTGGCACTTGG 0: 1
1: 0
2: 2
3: 24
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645547 Original CRISPR CTCTGCCTCTCGCTGGCACT TGG Exonic
900387470 1:2417132-2417154 CTCTACCTGTCGCTGGGATTGGG + Intergenic
900547688 1:3237622-3237644 CTCTTCCTCTCCCTGGCCCCCGG - Intronic
902304570 1:15526374-15526396 CTCTGCCCCTCTCTGGACCTCGG + Intronic
903127385 1:21257282-21257304 CTCTGCCTCTCTCTAGAACCAGG + Intronic
903259083 1:22121569-22121591 CTCTGCCTCCCACAGGGACTCGG - Exonic
904269923 1:29343287-29343309 CTCTTTCTCTCTCTGGCACCTGG + Intergenic
904608843 1:31714348-31714370 CTCTTCCTCTCTTTGGAACTCGG + Intergenic
904949885 1:34228315-34228337 CTCTGCATCTCCATGGCACCTGG - Intergenic
905237582 1:36560714-36560736 CACTGCCCCAAGCTGGCACTTGG - Intergenic
905246271 1:36616472-36616494 CTCTCTCTCTCACAGGCACTTGG + Intergenic
905410517 1:37765144-37765166 CTCCGCCCCCCGCTGGCTCTGGG - Intergenic
905474766 1:38218223-38218245 ATCTGCTTCTCACTGGCACCTGG + Intergenic
905581073 1:39082751-39082773 CTCTGCCCCTTGCTGCCTCTAGG + Intronic
905888606 1:41505499-41505521 GACTGCCTCTCGTTGGCACTCGG + Intergenic
906172241 1:43736302-43736324 CTCTGCCTCTTTCTGGTACTGGG + Exonic
907909848 1:58816161-58816183 CTCTGCCTCTCTCTCTCAATGGG - Intergenic
908165434 1:61453057-61453079 ATCTGTCTTTCTCTGGCACTTGG - Intronic
911256974 1:95644436-95644458 CTCTGCCTCTTGCTGTCACATGG + Intergenic
912252401 1:108025053-108025075 CTTTGCTCCTCTCTGGCACTAGG - Intergenic
912734628 1:112139379-112139401 CCCTGCTTCTCTCTGTCACTAGG + Intergenic
913218732 1:116642769-116642791 CGCTGCTGCTCGCTGGGACTTGG + Intronic
914392604 1:147235995-147236017 CTCTGCATCTGGCTGGCCCTTGG - Intronic
915646804 1:157278409-157278431 CTCTGCCTCTCACCTGCTCTTGG - Intergenic
915681658 1:157587227-157587249 CCCTGCCTCTCTCTGCCCCTTGG - Intronic
915898347 1:159828505-159828527 CTATGCCTGTCGCTGGCACAGGG - Intronic
916270238 1:162933151-162933173 CTTTTCCTCTGTCTGGCACTAGG + Intergenic
917567268 1:176225725-176225747 CACTGCCTTTCCCTGGCACTGGG - Intergenic
918595663 1:186289784-186289806 CTCTGCCTGTCCCTTGGACTGGG - Intergenic
920045555 1:203130012-203130034 CCCAGGCACTCGCTGGCACTTGG - Intronic
922334675 1:224609010-224609032 GACTGCCTCTCTCTGGCACGGGG + Intronic
1065201335 10:23316135-23316157 CTCTGCATCTGGCTTGCCCTTGG - Intronic
1065644350 10:27818938-27818960 CTCTGACTCTCCCAGTCACTGGG + Intronic
1065951159 10:30652337-30652359 CTCAGCCTCTCCCAGGCACACGG + Intergenic
1067741261 10:48897599-48897621 CCCTGCCTCTCGCAGGCCCCAGG - Intronic
1067820237 10:49521910-49521932 ATCGGCCTTTCACTGGCACTAGG - Intronic
1067848634 10:49741177-49741199 CTCTGGCTCTAGCTGGCACCTGG - Intronic
1068941935 10:62689088-62689110 CCCTGCCTCTTACTGGCAGTTGG - Intergenic
1069560553 10:69426454-69426476 CTCTGCCCCTTGCTGGCTCTGGG + Intergenic
1069692647 10:70363980-70364002 CTCTGCCTCTCGCAGGAAGCAGG - Intronic
1070640250 10:78163264-78163286 CTCAGCCTCAAGCTGGCTCTGGG + Intergenic
1071001697 10:80838363-80838385 CTCTGCATCTGTCTGGCCCTGGG + Intergenic
1072472274 10:95723764-95723786 TTCTGCCTCTAGTTGGCCCTCGG + Intronic
1072828081 10:98628710-98628732 CTCTGCCTCTAGCAGGCCCAAGG - Intronic
1073084757 10:100881018-100881040 CTCTGCCACTCACTGGCTGTGGG - Intergenic
1073429428 10:103476678-103476700 TTCTGCCTGTCTCTGTCACTGGG - Intronic
1073733691 10:106321060-106321082 CTCTGCATCTGGCTTGCCCTTGG + Intergenic
1074214477 10:111370721-111370743 CTCTTCCTGTAGCTGGGACTTGG + Intergenic
1075650748 10:124127279-124127301 CTCTGCTTCCCGGTCGCACTGGG + Intergenic
1076510569 10:131011346-131011368 CTCTGCATCCTGCTGGCCCTGGG - Intergenic
1076547199 10:131253322-131253344 CTCTGCCCCTCACTTGTACTGGG + Intronic
1077271330 11:1683457-1683479 CTCTGCCACCCGCTGCCACCCGG + Intergenic
1077921800 11:6647046-6647068 TTCTGCCCCTCGCTGGCCCTGGG - Intronic
1079321965 11:19458653-19458675 CTCTACCTCTCACTAGCTCTGGG - Intronic
1079850782 11:25531272-25531294 CTCTGCCTCTCCCTGGGCCTTGG - Intergenic
1080851444 11:36073592-36073614 CTCTGCCCCTGCCAGGCACTCGG + Intronic
1081004301 11:37715286-37715308 CTCTAACACTCTCTGGCACTGGG - Intergenic
1081037992 11:38174159-38174181 CTGTGCCTCTTGCTGCCTCTGGG + Intergenic
1081632682 11:44700574-44700596 CTCTACCCCTGGCTTGCACTAGG - Intergenic
1083492168 11:63021126-63021148 CGCTCCCTTTCGCTGGCACTTGG - Intergenic
1083626132 11:64073014-64073036 CTCTGCCTCTGGCTGCCTGTGGG - Intronic
1083679556 11:64344871-64344893 CTCTGCCTCCCGGTGGGCCTCGG - Exonic
1084558769 11:69890908-69890930 AGCTGCTTCTCGCTGGCAATGGG - Intergenic
1085485732 11:76861213-76861235 CTCAGCCTCCCGCTGGCCCAGGG - Intronic
1085508268 11:77072381-77072403 CTCTGCCTCTCGCCTTCACCAGG + Intronic
1085696725 11:78711045-78711067 CTCTGCTACTGGCTGGCCCTGGG - Intronic
1087356136 11:97097163-97097185 CTCTGCCTCTCTCATGTACTGGG - Intergenic
1088174809 11:107040598-107040620 CTCTGCCTATCACTGGGTCTTGG - Intergenic
1088425304 11:109695828-109695850 CTCTGCCTCTCTCATGTACTGGG - Intergenic
1089115807 11:116094110-116094132 CTCTGCCTGTCCCTGGCTGTAGG + Intergenic
1089497355 11:118914413-118914435 CTCTGCCTCTGGCTGTACCTGGG - Intronic
1089613164 11:119680927-119680949 CTCTGCCTTTAGCAGGCAGTGGG + Intronic
1091035046 11:132225273-132225295 CACTACCTCTCCCTGGCATTGGG - Intronic
1091281840 11:134386118-134386140 CACTGCCCGTGGCTGGCACTTGG - Intronic
1091284615 11:134401777-134401799 CCCTTCCTCTCCCAGGCACTTGG - Intronic
1092145756 12:6213663-6213685 CTCTGCATCTCTCTGGGACCTGG - Intronic
1092223560 12:6731587-6731609 CTTTTCCTCTCTCTGGCCCTTGG + Exonic
1092902862 12:13076150-13076172 CACAGACTCCCGCTGGCACTGGG - Intronic
1094711571 12:32968617-32968639 CTCTCTCTCTCTCTGGCACAGGG - Intergenic
1095283574 12:40384672-40384694 TTCTGCCTCTAGTTGGCCCTTGG - Intergenic
1096111354 12:49031114-49031136 TTCTGCCCCCCGCTGGCTCTAGG + Intronic
1099639712 12:85270829-85270851 CTCTACCACTCGCTGGCTGTGGG - Intergenic
1100455482 12:94747583-94747605 CTCTGCCTCTCACTGGATATGGG + Intergenic
1102034228 12:109761735-109761757 CTCTGCCTGGAGCTGGCAGTTGG + Intronic
1102525945 12:113512469-113512491 CTCTCCCTGTCGCTGGTCCTGGG - Intergenic
1103802669 12:123549431-123549453 TTCTGCCTCTAGTTGGCCCTCGG - Intergenic
1104997626 12:132668485-132668507 CGCTGCGACTGGCTGGCACTGGG + Exonic
1105791849 13:23808520-23808542 CTTTGCCTCTCTCTGTCTCTAGG + Intronic
1106414990 13:29539026-29539048 CTTTGTCTCTCCCTTGCACTTGG - Intronic
1106576349 13:30979133-30979155 GTCAGCCTCCCGCTGGGACTTGG + Intergenic
1106879159 13:34110313-34110335 CACTGCCTCAGGCTGTCACTGGG - Intergenic
1108249726 13:48551985-48552007 CTCTGTGACTGGCTGGCACTTGG + Intergenic
1108400399 13:50036115-50036137 CTCTGCCTCTTGTTGGCTATAGG + Intergenic
1109215604 13:59586176-59586198 CTCTGCCACTCTCTGCCAGTGGG + Intergenic
1110743081 13:79019703-79019725 CTCTGCCTCTCTCAGGTACTGGG + Intergenic
1111836838 13:93398720-93398742 CTCTGCCTCTCGAGGGTAATGGG - Intronic
1112132145 13:96535857-96535879 CTTTCCCTCTTGCTGGCATTAGG - Intronic
1112501463 13:99946541-99946563 CTCTGCCTCCCCCTGCCCCTTGG + Intergenic
1113031453 13:105997970-105997992 GCCTGCCCCTCACTGGCACTAGG - Intergenic
1113238126 13:108304440-108304462 CTCTGCCTCTCACTGCTCCTGGG - Intronic
1113294189 13:108939369-108939391 TTCTGCCTCTCTCATGCACTGGG + Intronic
1113508756 13:110834844-110834866 CTCTGCCCCTGTGTGGCACTTGG + Intergenic
1113626973 13:111854768-111854790 CTCTGCCTCCTGCGGGCATTTGG + Intergenic
1113732591 13:112652532-112652554 TTCTGTCTCTCTCTGTCACTTGG - Intronic
1115418439 14:33164761-33164783 CTCTGCCTCTTACTAGCTCTGGG - Intronic
1116159634 14:41252860-41252882 CTCTGCATCTGGCTTGCCCTTGG - Intergenic
1117334906 14:54748902-54748924 CTGCGCCTCCAGCTGGCACTCGG - Exonic
1118650423 14:67886454-67886476 CTCTGTTTCTTGCTGGCAGTGGG + Intronic
1119321202 14:73731745-73731767 CTCTGCTTCTCCATGCCACTGGG - Intronic
1120877385 14:89387651-89387673 CTCTCTCTCTCTCTGGCCCTTGG - Intronic
1121435377 14:93915696-93915718 TTCTTCCTCTCCCTGGCGCTGGG - Intergenic
1121466162 14:94116704-94116726 CTCTTCTTCTCGCTGGCTGTGGG + Intergenic
1121579935 14:95022049-95022071 CTCTGCATCTCACTGGCTCTTGG - Intergenic
1122035993 14:98949838-98949860 CCCTGCTTCTAGCTGCCACTTGG - Intergenic
1122049740 14:99048104-99048126 CTCTGCCTCTTCCTGGCTCTAGG + Intergenic
1122330301 14:100907493-100907515 CTCAGCCCTTCACTGGCACTTGG + Intergenic
1122716260 14:103698583-103698605 TTCTGCCTCTCCCTGGGTCTGGG - Exonic
1124371017 15:29104664-29104686 CTCTGCCTCCAGTGGGCACTGGG + Intronic
1125726903 15:41872776-41872798 CTCTGCCTCTCTCTTACACATGG - Intronic
1126325343 15:47471080-47471102 CACAGACTCTCTCTGGCACTTGG - Intronic
1129180805 15:73873805-73873827 CCCAGCCTCTGGTTGGCACTGGG + Intronic
1129296021 15:74600629-74600651 ATCTGCCTCCTGCTGGCTCTGGG + Intronic
1129331118 15:74827824-74827846 CTCTGCCACTGGATGGAACTAGG - Intronic
1129412334 15:75356784-75356806 CTCAGCCTCTCGCTGTAAGTGGG - Exonic
1130668081 15:85886526-85886548 CTCTGGCTCTCGCTGGCTGCTGG + Intergenic
1132183482 15:99781091-99781113 CTCTGCCTCTGACTAGCAATAGG - Intergenic
1134060577 16:11197329-11197351 CTAGGCCTCTCGCTGGTTCTGGG - Intergenic
1134094675 16:11411560-11411582 CTCTGCCTAGCTCTGGCACCAGG + Intronic
1135859961 16:26047214-26047236 TCCTGCCTCTGGCTGGCACAGGG + Intronic
1136382005 16:29900199-29900221 CTGTGACTCCCGCTGGCCCTAGG - Intergenic
1136672866 16:31873902-31873924 CTCTGCGACTTGCAGGCACTGGG + Exonic
1137561427 16:49504830-49504852 TTCTTCCACTAGCTGGCACTGGG - Intronic
1137564372 16:49524241-49524263 CTCTGCCACTTGCTAGCAGTGGG - Intronic
1138344940 16:56314927-56314949 CTCTGCCTCTGACTGGCTTTGGG - Intronic
1138420772 16:56897763-56897785 CTCTGCCTCCCTCTGTCCCTTGG + Intronic
1138980224 16:62259061-62259083 CTCTACCTCTCCCTAGCCCTTGG + Intergenic
1139091573 16:63654517-63654539 CTGTGGCCCTCTCTGGCACTAGG + Intergenic
1140592497 16:76370459-76370481 CTCTGCCTCAGGCTGCTACTTGG - Intronic
1141879678 16:86849479-86849501 CACTGCCTCTTGCAGGTACTGGG + Intergenic
1142482371 17:227046-227068 CCCTGCCTCTCGGCGGCACCCGG - Intronic
1144393614 17:14820645-14820667 CTGTGCATCTCGCTGGTCCTGGG + Intergenic
1146122104 17:30204769-30204791 ATTTGCCTCTCTCAGGCACTAGG + Intronic
1146530418 17:33603471-33603493 CTCTTCCTCTGCCTGGGACTTGG + Intronic
1148350557 17:46939003-46939025 CTCTCACTCTCGCTCTCACTGGG + Intronic
1149283897 17:55140351-55140373 CTCTGCCCCTTGCTGAGACTTGG + Intronic
1149858972 17:60110812-60110834 CTCTGCCACTTGCTGGCCATGGG - Intergenic
1151139291 17:71976217-71976239 CCCAGCCTCTCCCTGGAACTGGG - Intergenic
1152212246 17:79008957-79008979 TTCTCCCTCTGACTGGCACTTGG - Intronic
1152773366 17:82184672-82184694 CTCTGCTTCTCACTGTCAGTTGG - Intronic
1152911389 17:83006969-83006991 CTCTGCCTCTCGCCAGCACTGGG + Intronic
1153978416 18:10289413-10289435 CTCTGCCTCTCTCGGACATTCGG - Intergenic
1154098714 18:11447569-11447591 CTCTGCCTTTCTCACGCACTGGG - Intergenic
1156472551 18:37386971-37386993 CTGTGCCTCTCACTGGTCCTGGG + Intronic
1156589323 18:38468185-38468207 CTCTGCTTTTCCTTGGCACTCGG - Intergenic
1157519473 18:48335428-48335450 CTCTGCCGCTTGCTGGGTCTAGG - Intronic
1157807293 18:50667670-50667692 CTAAGCCTATCGCTGGCCCTGGG - Intronic
1157936149 18:51874878-51874900 CTCTGCCTCTCTCACGTACTGGG + Intergenic
1158116190 18:53998652-53998674 GTCTGGCTCTGCCTGGCACTTGG - Intergenic
1160232127 18:77056509-77056531 CCCTGCCTCCCGCAGGGACTGGG - Intronic
1160527334 18:79545392-79545414 CTCATCCTCTCGCTGGTAATGGG - Intergenic
1160985411 19:1836362-1836384 TGCCGGCTCTCGCTGGCACTGGG - Intronic
1161267078 19:3369384-3369406 CTCTGTCTCTCTCTGTCTCTGGG + Intronic
1161562017 19:4978714-4978736 CTGTGCCTGTCGCTGGCTCAGGG + Intronic
1162869393 19:13574074-13574096 CTCTGTCTCTCTCTGTCTCTGGG - Intronic
1163063003 19:14773864-14773886 CTCTGTCCCCCACTGGCACTGGG + Intronic
1164573767 19:29393128-29393150 CTCTGCCTCTTGCTTGCTGTGGG + Intergenic
1164629851 19:29754931-29754953 CTCTGCCTCTCACTTGCAGCAGG - Intergenic
1165137514 19:33679025-33679047 CTCTCCCTGTGGCTGGCACAAGG - Intronic
1165141197 19:33700943-33700965 CCCTGCCTATTTCTGGCACTTGG - Intronic
1165256330 19:34579013-34579035 CTGGGACTCTGGCTGGCACTGGG + Intergenic
1165259053 19:34597502-34597524 CTGGGACTCTGGCTGGCACTGGG + Intronic
1166106244 19:40599504-40599526 CTCTTCCTCACGCTGGGGCTGGG - Exonic
925578482 2:5385093-5385115 CTCTGCCCCTGGCTGGGACCTGG + Intergenic
927865222 2:26583667-26583689 ATCTGCCTCAGGCTGGCCCTGGG + Intronic
928461480 2:31477227-31477249 CTCTATCTCTTGCTGGCTCTAGG + Intergenic
934526359 2:95054233-95054255 AGCTGCCCCTGGCTGGCACTTGG - Intergenic
934862907 2:97779395-97779417 CTCTGCCTCCCGCTTGCCCCTGG + Intronic
934916017 2:98301611-98301633 CATTCCCACTCGCTGGCACTGGG - Intronic
935293577 2:101629416-101629438 CTTTTCTTCTCACTGGCACTGGG + Intergenic
935748463 2:106209972-106209994 CTCTGCCTCTAGTCGGCCCTCGG - Intergenic
936387622 2:112044208-112044230 TTCTGCCTCTAGTTGGCCCTCGG + Intergenic
936671493 2:114662185-114662207 CTCCGCCTCTCGCTCCCCCTCGG - Intronic
936876601 2:117197255-117197277 CTGTGTTTCTCCCTGGCACTTGG + Intergenic
939583277 2:143976920-143976942 CTCTGCCTCTGTCTAGCAGTAGG + Intronic
939618588 2:144389838-144389860 CTCCGCCTCCCGCTTGCAGTAGG + Exonic
940250022 2:151664912-151664934 CTCTTCCTCTTGCTAGCATTGGG - Intronic
941506704 2:166355186-166355208 CTCTGCCTCTTGGCAGCACTGGG + Intronic
942241221 2:173965036-173965058 TTCTGCCTCTCACAGACACTCGG + Intronic
942580589 2:177412371-177412393 TTCTGCCTCTAGTTGGCCCTTGG + Intronic
1168887656 20:1270998-1271020 CTCAGCCTCTCCATGGCCCTTGG - Intronic
1171351485 20:24506415-24506437 CTCTCCCTCTCTTTGGCGCTTGG - Intronic
1175286334 20:57839325-57839347 GTCTGCAACTCCCTGGCACTTGG - Intergenic
1176085860 20:63295138-63295160 CTCTGCCTCTGGCTGTGGCTGGG + Exonic
1178342792 21:31800471-31800493 CTCTGCCTCTCACTCTAACTGGG - Intergenic
1178464616 21:32835418-32835440 CTCTGCCTGTAGTTGGCACTCGG + Intergenic
1179150562 21:38805589-38805611 CTCCGCCTCCTGCTGTCACTCGG - Exonic
1179259491 21:39745619-39745641 TTCTGCCTCTAGTTGGCCCTTGG + Intronic
1179537699 21:42062997-42063019 CCCTGCCTCTCCCAGGCTCTGGG + Intronic
1182087171 22:27569223-27569245 CACTGCCTGTGTCTGGCACTGGG - Intergenic
1183984282 22:41561113-41561135 CTCTGTCTCTCTCTGGCTCGTGG - Exonic
1184251135 22:43260984-43261006 TGCAGCCTCTCCCTGGCACTGGG + Intronic
1184758801 22:46533438-46533460 CTCTCCCCCTCGCTGGGCCTAGG + Intronic
949596929 3:5557884-5557906 CTCTGGTTCTCTCTGGCCCTGGG - Intergenic
950212134 3:11131618-11131640 GGCTGCCTCTGGCTAGCACTGGG - Intergenic
950423387 3:12911728-12911750 CTCTGTCTCTGGCTGCCTCTAGG - Exonic
951201065 3:19875830-19875852 TTCTGCCTCTAGTTGGCCCTCGG + Intergenic
954198887 3:49012592-49012614 CTGTGACTCTGGCTGGCTCTTGG + Exonic
954292837 3:49658735-49658757 CTCTGCCCCTACCTGGCCCTCGG + Intronic
954387912 3:50254073-50254095 CTGTGACCCTCGCTGGCCCTAGG + Intronic
954486055 3:50852092-50852114 CTCTGCCTCTTGCACGTACTAGG + Intronic
955339197 3:58111914-58111936 CTCTGCCAGCCGGTGGCACTGGG + Intronic
956707776 3:72014095-72014117 CTCTGCCACTGGCCAGCACTAGG + Intergenic
957005412 3:74940004-74940026 CTCTGCCTCCCTCTGGCCCATGG - Intergenic
962873351 3:139517345-139517367 CTCTGCCCATGGGTGGCACTAGG + Intergenic
963045956 3:141102914-141102936 CTCTGCCTCTACCTCACACTTGG + Intronic
965056310 3:163721666-163721688 CTCTGCACCTGGCTGGCCCTTGG - Intergenic
968531396 4:1093829-1093851 CTGGGCCTCTGGCTGGCTCTGGG + Intronic
968854942 4:3112887-3112909 CTCTGGTCCTCGCTAGCACTTGG + Intronic
969228921 4:5816406-5816428 CCCTGCCTCTTGCAGGCACTGGG - Intronic
969271696 4:6107599-6107621 CTCTGCCTCCCGGCTGCACTGGG + Intronic
969437624 4:7197841-7197863 CCCTGCCACTCTCTGGCTCTGGG + Intronic
970997797 4:22287787-22287809 CCCTGACTCCCTCTGGCACTTGG - Intergenic
971740260 4:30510529-30510551 CTCTGCATCTAACTGGCAGTAGG - Intergenic
977324994 4:95563932-95563954 CTCTGCCTTTCTCTGGCCATTGG + Intergenic
978189533 4:105895887-105895909 CTCCGCCTCGGGCGGGCACTCGG - Intronic
979141745 4:117184117-117184139 CTCTGTATCTCTCTGGCCCTGGG - Intergenic
979956273 4:126956691-126956713 CTCTGCATCTGGCTCGCCCTTGG + Intergenic
980173828 4:129321278-129321300 CTCTGCTTCACCCTGGCACAAGG + Intergenic
982712340 4:158769424-158769446 CGCTGCCTATCGCCGGCACCTGG + Intronic
983662711 4:170145719-170145741 CACTGCTTCTTGCTGGCACATGG - Intergenic
985148442 4:186919512-186919534 GCCTGCCTCTCGCTGACATTCGG - Intergenic
985570804 5:643741-643763 CTCTGCCCCTCCCTGGCCCCAGG - Intronic
985863763 5:2495458-2495480 CTCTGATTCCCGCTGGCACGGGG - Intergenic
987082672 5:14439683-14439705 CTCTGCCTCTCGCTGGGTCCTGG + Intronic
987665781 5:20937134-20937156 ATCTGCCTCTCTCTAGCACGAGG - Intergenic
987962246 5:24824853-24824875 CTCTGCCTCTCTCATACACTGGG + Intergenic
988423089 5:31030095-31030117 TTCTGCCTCTAGGGGGCACTTGG - Intergenic
988598995 5:32622061-32622083 CTCTGCCACTTGTTGGCAGTGGG + Intergenic
988756910 5:34265033-34265055 ATCTGCCTCTCTCTAGCACGAGG + Intergenic
991206027 5:64051245-64051267 CTCTGCATTCCGCTGGCACCTGG + Intergenic
992221816 5:74580829-74580851 CTCTGCCTCTAGCTGGAACTAGG + Intergenic
993144023 5:84071006-84071028 CACTGCTTCTCACTGGCAGTGGG - Intronic
999154537 5:149448986-149449008 GTTTGCCTCTCCCTGGCACAGGG + Intergenic
999195136 5:149776756-149776778 CTCTGCCACTTGCTAGCTCTGGG + Intronic
999375598 5:151084511-151084533 CCCTGCCGCTCTCTGGCCCTTGG - Intronic
1001528122 5:172443598-172443620 CTTAGCCTCTCTCTGGCTCTGGG + Intronic
1002868658 6:1146506-1146528 CTCTGCCTATCTCTGGCTCTGGG - Intergenic
1003118205 6:3297487-3297509 CTGGGCCTCTCCCTGGCACCTGG - Intronic
1003213971 6:4091877-4091899 CTGTGCCTGTCGCTGCCTCTGGG - Intronic
1004286190 6:14322890-14322912 CTCTTCCTCTCCCAGGCACATGG - Intergenic
1004605490 6:17190641-17190663 CACTGCCCCTGGCTGGGACTGGG + Intergenic
1005784573 6:29229836-29229858 CTCTACATCTCCCTGGCATTGGG - Intergenic
1005962489 6:30704009-30704031 CTCTGCCTCTTGATGCAACTGGG + Exonic
1006140662 6:31927721-31927743 CTCTACCTCTCGCCGCCCCTAGG + Exonic
1006446978 6:34085060-34085082 CTCTGTCTCACGCTGGGGCTGGG + Intronic
1006811242 6:36821842-36821864 TTCTGCGTCTCCCTGGGACTGGG + Intronic
1008428574 6:51388068-51388090 CTCTGCCTTTCTCTTTCACTGGG - Intergenic
1010354314 6:74912452-74912474 CTCTGCCTCTCTCATGTACTGGG + Intergenic
1010771960 6:79842125-79842147 CTTTGCCTCTTTCTGACACTGGG - Intergenic
1011715158 6:90097455-90097477 CTCTGCCACTCACTGGCTATGGG - Intronic
1015289429 6:131521117-131521139 CTCTGCCTCTCTCATGGACTTGG + Intergenic
1015934326 6:138393220-138393242 CTCTGCCACTTTCTGGCCCTGGG - Intergenic
1016343547 6:143086918-143086940 CTCTGCCTCTAGTTGGCCCTCGG + Intronic
1017151198 6:151282175-151282197 CTCTGCCTCCCGCTCGAACCTGG - Intronic
1017799514 6:157880634-157880656 CTGTGGCTCACGATGGCACTCGG - Intronic
1019348912 7:544066-544088 CTCTGCCCCTTGCTGGCCATGGG - Intergenic
1020152131 7:5690701-5690723 CTCTACCTCTCACTAGCCCTGGG - Intronic
1020675843 7:11184113-11184135 CTCTACATCTCACTAGCACTTGG + Intergenic
1021842076 7:24728870-24728892 CTCTTTCTCTCTCTGTCACTTGG + Intronic
1022216641 7:28269600-28269622 CTCTGCCCCTCACTGTCACCTGG - Intergenic
1023529143 7:41135658-41135680 CTCTGCACCTGGCTGGCCCTTGG - Intergenic
1023660924 7:42470131-42470153 CTCTGCCTCCTATTGGCACTTGG - Intergenic
1023853351 7:44163166-44163188 CTTTGCCACTCACTGGCTCTAGG + Intronic
1024612400 7:51078834-51078856 CTCAGCGCCTCGCTGGCAGTTGG + Intronic
1024670101 7:51586394-51586416 CACTGCCTCTCACCTGCACTGGG - Intergenic
1024740157 7:52344763-52344785 CTGTTCCTCTCTCTGGCAGTAGG - Intergenic
1024786407 7:52912026-52912048 CTCTGCATCTGGCTTGCCCTTGG + Intergenic
1025256370 7:57386184-57386206 CTCTGCCTCTCCTTGGCAGGGGG + Intergenic
1029701314 7:102248588-102248610 CTCGGCCTCTCCCTGAGACTTGG - Exonic
1031975333 7:128090068-128090090 CTCTGGCTCGGGGTGGCACTGGG - Intronic
1035095960 7:156355795-156355817 CACTGCCTCCGGCTGACACTGGG + Intergenic
1035304761 7:157924513-157924535 CTCTGACTCTGGGTGGCACCTGG - Intronic
1036599798 8:10249838-10249860 CTCAGCATCTGGCTGGCACTAGG + Intronic
1036645547 8:10609692-10609714 CTCTGCCTCTCGCTGGCACTTGG + Exonic
1037718242 8:21418193-21418215 TTCTGCCTGTCTCTTGCACTTGG - Intergenic
1040864219 8:52032026-52032048 CTCAGGCTCCCGTTGGCACTGGG + Intergenic
1042838542 8:73100259-73100281 CTCTGCCCTTCGCTGACACAAGG - Intronic
1044737879 8:95297608-95297630 CTCTGCCTCTAGGTGTCTCTTGG + Intergenic
1044955436 8:97475315-97475337 CTCTGCCTCTCTCATGTACTAGG - Intergenic
1046811476 8:118538202-118538224 CTCTCCCTCTCTCTGGGATTGGG + Intronic
1049021525 8:139960620-139960642 CTCTGCCTCTCGCCAGCTGTAGG + Intronic
1049253534 8:141602028-141602050 TTCTACCTCTGGCTGGCCCTTGG + Intergenic
1050687600 9:8189805-8189827 CTCTGCCTCTCTCATGCATTAGG - Intergenic
1052851521 9:33381264-33381286 CTCTGCCACAGGCTTGCACTAGG - Intergenic
1053431426 9:38044123-38044145 CCCTGCCTCTCTCTAGCACAAGG + Intronic
1053470924 9:38345760-38345782 TTCTGCCACTAGCTGGCACGTGG + Intergenic
1053511093 9:38688227-38688249 CTGAGCCAATCGCTGGCACTGGG + Intergenic
1054798536 9:69325076-69325098 GTCCGCCTCCCGCTGGCCCTGGG - Intronic
1055983594 9:82032238-82032260 CACTGCCTCTGGCTGGCAGAGGG - Intergenic
1057111467 9:92476180-92476202 CTCAGCTGCTCTCTGGCACTCGG - Intronic
1057282174 9:93720797-93720819 CTCTGACTCTACCTGGCTCTTGG + Intergenic
1057858186 9:98618580-98618602 CTCTGTCTATCTCTGTCACTGGG + Intronic
1057887221 9:98838995-98839017 CTCAGCCCCTCTCTGGCTCTGGG + Intronic
1059479812 9:114580382-114580404 GACTGCCTTTCCCTGGCACTAGG - Intergenic
1060598047 9:124859850-124859872 CACTGCCTCTTACTGGCACTGGG - Intronic
1061291134 9:129650968-129650990 CCCTGGCTCCCGCTAGCACTCGG - Intergenic
1061863512 9:133479553-133479575 CCCTGGCTCTCCCTGGCACCAGG + Intergenic
1186505617 X:10089740-10089762 CTCTGCCACTCACTGGCTGTGGG - Intronic
1186788731 X:12976209-12976231 CTCTTCCTCACGCTCGCTCTTGG + Exonic
1188654219 X:32670447-32670469 CTCTGCCTCTTACTAGCACAAGG + Intronic
1193026718 X:76852653-76852675 CTCTGCCTCTCTCTTGTACTAGG + Intergenic
1194330075 X:92571819-92571841 CTCAGCCTTTCTCTGCCACTAGG + Intronic
1196138608 X:112236092-112236114 CTCTTCCCCTCTCTGGCACTTGG - Intergenic
1198500795 X:137244384-137244406 CTCTGCTTCTGTCTGTCACTAGG + Intergenic
1200000861 X:153059081-153059103 CACAACCTCTGGCTGGCACTGGG - Intronic
1200252858 X:154562968-154562990 CTCTGACCCACCCTGGCACTGGG + Intronic
1200264909 X:154641448-154641470 CTCTGACCCACCCTGGCACTGGG - Intergenic
1200638782 Y:5691001-5691023 CTCAGCCTTTCTCTGTCACTAGG + Intronic
1202196931 Y:22306677-22306699 CTCTGCCTCTGTCTGGCGCTGGG + Intergenic