ID: 1036645605

View in Genome Browser
Species Human (GRCh38)
Location 8:10610000-10610022
Sequence TTGAAGAAACAGGAGGAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 1, 1: 0, 2: 4, 3: 102, 4: 943}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645605 Original CRISPR TTGAAGAAACAGGAGGAGAA GGG (reversed) Exonic
900340125 1:2184559-2184581 TTGGAAAAACAATAGGAGAAGGG - Intronic
900671745 1:3858683-3858705 GAGAAGCAACAGGAGGAGGAAGG - Intronic
902411917 1:16216770-16216792 GCGAAGAAACAGAAGCAGAAAGG + Intergenic
902450118 1:16491389-16491411 ATGAAGAGAGGGGAGGAGAAGGG + Intergenic
902476767 1:16692583-16692605 GCGAAGAAAAAGGAAGAGAAGGG - Intergenic
902502719 1:16921758-16921780 ATGAAGAGAGGGGAGGAGAAGGG - Intronic
903098059 1:20999435-20999457 TTGAAGAAAATGGAAGAGAGGGG + Intronic
903139798 1:21332646-21332668 GGGAGGAAACAGGAGGAGAGCGG + Intronic
903142717 1:21348935-21348957 ATGAAGAAAGCAGAGGAGAAAGG + Intergenic
903562734 1:24240646-24240668 TTGGAGAAACATGAGGGAAAAGG + Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
904377585 1:30091479-30091501 GGGAAGAAAAAGCAGGAGAAGGG + Intergenic
904413611 1:30341407-30341429 TGGAAGAAAAAGGAAGGGAAAGG + Intergenic
904422225 1:30401687-30401709 GGGAAGACAAAGGAGGAGAAAGG + Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904597053 1:31653529-31653551 TAGAAGAAACAGAAAGAAAAGGG + Intronic
904602961 1:31683815-31683837 AGGAAGAAGCTGGAGGAGAAGGG - Intronic
904681254 1:32230913-32230935 TGGAAGAACCTGGAGGAAAAGGG - Exonic
904761489 1:32807843-32807865 ATGAAGAGACTGAAGGAGAATGG - Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907621300 1:55983482-55983504 GGGAAGAAAGAGGAGGAGAGGGG + Intergenic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
909135359 1:71792421-71792443 TTGGTGAAACAGGATGAGAAGGG - Intronic
909362732 1:74782895-74782917 AAGAAGAAGCGGGAGGAGAAGGG - Intergenic
909385528 1:75051352-75051374 TGGAAGAAACAGTAGTGGAAGGG + Intergenic
909787645 1:79635823-79635845 GTGGAGAAAGAGGAGGAGACAGG + Intergenic
909832052 1:80203950-80203972 TGGATGAAAAAGGAGTAGAAAGG - Intergenic
910498943 1:87866328-87866350 TAGAAGAAAAAGGTGGAGAAAGG - Intergenic
911032180 1:93500870-93500892 TTAAACAAACAGGAGGGAAACGG - Intronic
911204942 1:95082602-95082624 TTGAAGAAAAAGCAAGAAAAAGG - Intergenic
911461378 1:98195455-98195477 TTGAAGAGCAAAGAGGAGAAAGG + Intergenic
911940338 1:104038202-104038224 TTGGACATACAGTAGGAGAAAGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912092709 1:106101140-106101162 TTCAATTAACAGGATGAGAAGGG + Intergenic
912920556 1:113862449-113862471 TTCAAGAAAGGAGAGGAGAATGG + Intronic
913332361 1:117678096-117678118 AGGAAGAAAGAGGAGGAGGAAGG + Intergenic
913718006 1:121558199-121558221 TTAAGGAAAGAGGAGGGGAAGGG - Intergenic
914460972 1:147884888-147884910 TAGAACAAAAAGCAGGAGAAAGG + Intergenic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
915041306 1:152970320-152970342 TTGAAGAAAAAAGAGGAAGAGGG - Intergenic
915043977 1:152995645-152995667 TTCGAGATACAGGGGGAGAAGGG + Intergenic
915506186 1:156357785-156357807 TGGAGGAATCAGAAGGAGAAGGG + Intronic
915582923 1:156826119-156826141 TTAAAGACACCTGAGGAGAAAGG + Intronic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
916922067 1:169479157-169479179 TTAATGAAACAGTAGGATAAAGG - Intronic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917188840 1:172391748-172391770 TTTCAGATACAAGAGGAGAAAGG - Intronic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917375298 1:174346276-174346298 TTTCAAAAAAAGGAGGAGAAAGG - Intronic
917742432 1:177973966-177973988 GTGGAGAGACTGGAGGAGAAGGG + Intronic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
919040965 1:192387895-192387917 TGGAACAAAAAGGTGGAGAAAGG - Intergenic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
920089686 1:203443413-203443435 TTGCAGAATCAGGAGGAAAAGGG - Intergenic
920231539 1:204473865-204473887 TTGAAGATACAGGAGAGGGAAGG - Intronic
920714499 1:208326912-208326934 TATAATAGACAGGAGGAGAAAGG - Intergenic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921315749 1:213888553-213888575 TTGGAGAAAGAGGAGGAGTAAGG + Intergenic
922064233 1:222121114-222121136 GTGAAGAAACTGGAGAGGAAAGG + Intergenic
922067444 1:222157928-222157950 TTGAAGACACAGCAGAAAAAGGG + Intergenic
922105281 1:222508266-222508288 GGGAAGAAAAGGGAGGAGAAGGG + Intergenic
922265614 1:223980844-223980866 GGGAAGAAAAGGGAGGAGAAGGG + Intergenic
922483251 1:225954114-225954136 TTTAAAAAACAGCAAGAGAAGGG - Intergenic
923181083 1:231520430-231520452 TTGTAGAAAGAGGAGGGGAGAGG + Intergenic
923199885 1:231701124-231701146 TGGAAGGCAAAGGAGGAGAAAGG + Intronic
923541069 1:234888579-234888601 TGGAAGGCAAAGGAGGAGAAAGG - Intergenic
923651916 1:235882185-235882207 TTGAAAAAAGAGGAGGAGTTTGG + Intronic
923908047 1:238407864-238407886 GTGAAGAAAGAGGAAGAGACAGG + Intergenic
924308655 1:242718116-242718138 ATGAAGAAAGAGGAGAAGCAAGG + Intergenic
924444386 1:244115670-244115692 TAGAAACAAAAGGAGGAGAAAGG + Intergenic
924716314 1:246577714-246577736 TTGAAGAAACAAAAGTGGAAAGG + Intronic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1063159486 10:3408875-3408897 AGGAAGAAAGAGGAGGAGAGAGG + Intergenic
1063159507 10:3408952-3408974 AGGAAGAAAGAGGAGGAGGAGGG + Intergenic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063516036 10:6696445-6696467 TGGAAGAAATAGAAGAAGAAAGG + Intergenic
1063742799 10:8842646-8842668 TTAAAGAAAAAGGAGGGGATGGG - Intergenic
1063936809 10:11086870-11086892 TTAAAGGGACAGGAGGAGATGGG + Intronic
1064135543 10:12747486-12747508 TTGAAGAGACAGGAGCGGAGGGG + Intronic
1064250373 10:13702003-13702025 ATAAAGAATCAGGAGAAGAAAGG + Intronic
1064559687 10:16583915-16583937 TTGATGAAACAGGCAGAGATTGG - Intergenic
1064704895 10:18061520-18061542 TTGAAGGAACAGGGGGAGTGGGG + Intergenic
1064794125 10:18992061-18992083 TTGAAGAAACAGGCAAAGAAGGG + Intergenic
1065565472 10:27003329-27003351 GTGAACAAATAGGGGGAGAAGGG - Intronic
1066284379 10:33950428-33950450 TTGAAGGAACAGGAAGAAACTGG + Intergenic
1066411923 10:35179958-35179980 GAAAAGAAAAAGGAGGAGAAAGG + Intronic
1066495218 10:35935962-35935984 AGGAAGAATGAGGAGGAGAAGGG - Intergenic
1066647122 10:37621283-37621305 AGGAAGAATGAGGAGGAGAAGGG + Intergenic
1066717258 10:38299453-38299475 TGGAAGTAACAGGAGTATAATGG + Intergenic
1066765303 10:38797241-38797263 TGGAATAGAAAGGAGGAGAAAGG - Intergenic
1067324659 10:45255981-45256003 TGGCAGACACAGGAGGAGGATGG + Intergenic
1067373431 10:45705717-45705739 TTGAGAAAACAGAAGCAGAAAGG + Intergenic
1067380262 10:45766497-45766519 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067701515 10:48576330-48576352 TTGGATGACCAGGAGGAGAATGG - Intronic
1067887963 10:50107151-50107173 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1068226529 10:54113887-54113909 TGGAAGGCAGAGGAGGAGAAAGG + Intronic
1068352844 10:55871363-55871385 TTGAAGACAGAGCAGGAGATAGG + Intergenic
1068959865 10:62855735-62855757 AGGAAGAAAGAGGAGCAGAAAGG + Intronic
1069103672 10:64356496-64356518 TGGATGAAAAAGGAAGAGAAGGG + Intergenic
1069540952 10:69293407-69293429 TTGGAGATACTGGAGGAGGAAGG + Intronic
1069718538 10:70535673-70535695 AAGAAGAAAAAGGAGAAGAAAGG - Intronic
1070052094 10:72899217-72899239 CTGAAGAAATAGAAGGGGAAAGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070477063 10:76839242-76839264 TTGAAGACACTGGAGGATACTGG + Intergenic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070652182 10:78245444-78245466 TTGAGAAAACATGAAGAGAAAGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071195819 10:83158004-83158026 GTGGAGGAACAGGAGGTGAATGG + Intergenic
1071237372 10:83664870-83664892 TTGAAGAAATTGAAGGATAATGG - Intergenic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072742028 10:97915269-97915291 TTTAAGCATCAGGAGGAGATGGG + Intronic
1072808418 10:98440816-98440838 TTCAATAAAGAGGAAGAGAAAGG + Intronic
1073172217 10:101520073-101520095 ATGAAGAAAAAGCAGGATAAGGG - Intronic
1073586466 10:104715278-104715300 TAGAACAAAAAGGAGGAGAAAGG + Intronic
1074260240 10:111846349-111846371 TAGAAGAAAAAGGTAGAGAAAGG - Intergenic
1074473423 10:113747761-113747783 TGGAAGAAACAGGAGAAGAGTGG + Intergenic
1074994270 10:118742459-118742481 TTGATGAAACTGTAAGAGAAAGG - Intronic
1075141644 10:119842587-119842609 TTGAAACAACTGAAGGAGAAAGG + Exonic
1075268598 10:121028065-121028087 TTGAAAAACAGGGAGGAGAAGGG - Intergenic
1075473190 10:122709509-122709531 TTAAAGAAAAGTGAGGAGAAGGG + Intergenic
1075539959 10:123304040-123304062 TGGAAGAAAAAGGTGCAGAAGGG - Intergenic
1075758024 10:124831665-124831687 TTGAAGAAAAAGAAGACGAAAGG + Intronic
1076049424 10:127320856-127320878 TAGAAGAATCTGGAGGTGAAGGG - Intronic
1076121729 10:127941725-127941747 TTGTAGAAAGAGCAGGGGAATGG - Intronic
1076278815 10:129227881-129227903 ATGAAGAACCAGGAGAGGAATGG - Intergenic
1076349891 10:129808517-129808539 TTGAAGAAAGAGGAGCTGAGGGG - Intergenic
1077772923 11:5240415-5240437 TTAATGAAACTGGAGAAGAAAGG + Intergenic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078006353 11:7535320-7535342 TTGAGGAAACAGCATGACAAAGG + Intronic
1078507669 11:11964790-11964812 TTGAAGAGACAGGAGAGGAGGGG - Intronic
1078831113 11:14978019-14978041 CAGAAGAGACAGGAGAAGAAGGG + Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079770832 11:24457512-24457534 TAGAAAACACAAGAGGAGAAGGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081108681 11:39104743-39104765 GTGAAGACACAGGAGGAAGATGG - Intergenic
1081191203 11:40104707-40104729 TAGAGGACCCAGGAGGAGAAAGG - Intergenic
1081201639 11:40223295-40223317 TTTAAAAATCAGTAGGAGAAAGG + Intronic
1081583185 11:44366316-44366338 TTGAAGAAACAGACGTAGAGAGG - Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1081877104 11:46416098-46416120 TTGGAGAAACAGGGAAAGAAAGG + Intronic
1082796486 11:57381530-57381552 GGGAAGAAACAAGAGGGGAAAGG + Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1084104773 11:66974279-66974301 TTTAAGAAACAGAAGGAAACAGG - Intergenic
1084446567 11:69207000-69207022 TAAAAGGAAAAGGAGGAGAAAGG - Intergenic
1084502985 11:69545816-69545838 GTGAAGACAGAGGAGGAGATTGG + Intergenic
1085945055 11:81259620-81259642 TAGAAGAAAAAGGCAGAGAAGGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086009815 11:82087540-82087562 TGTTAGAAACAGGACGAGAAGGG + Intergenic
1086283015 11:85212848-85212870 TTGAGGTAATAGGATGAGAAAGG - Intronic
1086821277 11:91438977-91438999 TTGAAGGAAAACAAGGAGAATGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086871107 11:92037749-92037771 TTGAAGTTACAGGAGAAAAAAGG + Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087982403 11:104632169-104632191 TAGAAGAAAAAGGTGGAGTAAGG + Intergenic
1088502305 11:110494604-110494626 TAAAACAAAAAGGAGGAGAAAGG - Intergenic
1088502611 11:110497730-110497752 TTGGAGCAACAGGAAGAGACAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089429114 11:118406525-118406547 TTGAAGAAAGAGGTGAAGAAAGG - Intronic
1089661767 11:119990728-119990750 TGGAGGAAACAGGATGAGACAGG - Intergenic
1089980667 11:122769481-122769503 TAGAAGAAAAATGAGGATAAGGG - Intronic
1090106379 11:123857033-123857055 TGGAAGACAAAGGGGGAGAAAGG + Intergenic
1090581564 11:128165838-128165860 ATGAAGAAAAAGGAGAAGAAAGG - Intergenic
1090827618 11:130398847-130398869 TAACAGAAACAGAAGGAGAAAGG + Intergenic
1090879495 11:130821120-130821142 CTGCAGAAACAGGAGGAAACAGG + Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091086059 11:132723106-132723128 CTGAAGAAACAAGAGAACAAAGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091537388 12:1424646-1424668 ATGAAGAAACAAGAGGAAAAGGG - Intronic
1092511811 12:9164589-9164611 TGTAAGAAATAGGAGAAGAAAGG - Intronic
1092711159 12:11339285-11339307 TTGAAAAAAGATGAGAAGAATGG - Intergenic
1092927096 12:13281215-13281237 TAGATGAGACAGGAAGAGAAAGG - Intergenic
1092966202 12:13645864-13645886 TTTAAGTAACAGAAAGAGAAGGG + Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093224067 12:16459971-16459993 TTGTAGAAACAGAAGGTTAATGG + Intronic
1093353516 12:18133605-18133627 TTGAAGGCAAAGGAGAAGAAAGG - Intronic
1094035719 12:26068357-26068379 TAGAAGAAAAAGAAGGAAAAGGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1094789909 12:33900549-33900571 ATGATGATATAGGAGGAGAAAGG - Intergenic
1095257188 12:40052328-40052350 TTGAGGATAAAGGAGGAGACAGG - Intronic
1095350579 12:41205868-41205890 ATGAAGGAACAGGGGAAGAAGGG - Intronic
1095517389 12:43021498-43021520 AGGAAGGAACAGGACGAGAAAGG + Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1096000659 12:48127242-48127264 TTGAAGGAACAGGAAGGGGAAGG - Intronic
1096066950 12:48748658-48748680 TTGAAGAAACAGGAGAAGGTAGG - Intergenic
1096584159 12:52608667-52608689 ATGAACAAACAGGAGTAGCAAGG + Intronic
1096682770 12:53268028-53268050 CTGAAGATAAAGGAGGAAAAGGG + Intergenic
1097365052 12:58702558-58702580 TTGAAAAAACATTAGGTGAATGG + Intronic
1097469089 12:59966443-59966465 AAGAAGAAAGAGGAAGAGAAAGG - Intergenic
1097645714 12:62233758-62233780 TTAAAAGAACAGGAGCAGAAGGG - Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098745453 12:74232130-74232152 TAGAAGAAAGAGGAGGAAAGTGG - Intergenic
1098817357 12:75184035-75184057 TTGAAGAAACAGTAGGGAATAGG - Intronic
1098996763 12:77129449-77129471 TTGTAGACCCAGGAGGACAAGGG + Intergenic
1099172056 12:79376566-79376588 TCTAAGTAACAGGATGAGAAAGG - Intronic
1099383782 12:81989133-81989155 TGGAAGACAAAGGAGGAGCAAGG + Intergenic
1099785099 12:87252269-87252291 TAAAACAAAGAGGAGGAGAAAGG - Intergenic
1099930695 12:89070992-89071014 TTTAAGAATCTGGAAGAGAATGG - Intergenic
1099947213 12:89258367-89258389 ATGAAGACACAGGAAGAAAATGG + Intergenic
1099984379 12:89646174-89646196 TTGAAGAATTAGGAGGAAAGGGG + Intronic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101269408 12:103128001-103128023 ATTCAGAAAAAGGAGGAGAAAGG - Intergenic
1101398416 12:104367858-104367880 TAGAAGAAAAAGGTGGAGGAAGG + Intergenic
1101467202 12:104960294-104960316 TTGAAGAATAAGGAGGAGTTAGG + Intergenic
1101593355 12:106141414-106141436 TTGAAGAAACCGTATCAGAAAGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102122598 12:110453988-110454010 TTACAGGAAGAGGAGGAGAAGGG + Intronic
1102243218 12:111338453-111338475 ATGAAGAAGCTGGAGAAGAAAGG + Exonic
1102329420 12:112015821-112015843 TTCAAAAGACAGTAGGAGAATGG - Intronic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102864106 12:116360587-116360609 TGGAAGACTGAGGAGGAGAATGG - Intergenic
1103166913 12:118778197-118778219 TTGAAGACAGAGGTGGAGACTGG + Intergenic
1104467649 12:129003835-129003857 TTGGAGGAACAGGAGAAGAAGGG + Intergenic
1105332164 13:19427925-19427947 TTTAAGAAACAATAGTAGAATGG + Intronic
1105585346 13:21738111-21738133 TCCCAGAAATAGGAGGAGAAGGG + Intergenic
1105594726 13:21826804-21826826 TTGACAAGACAGCAGGAGAAGGG - Intergenic
1105759400 13:23499603-23499625 TGAAAGAAACAGAAGAAGAAAGG + Intergenic
1105880794 13:24605146-24605168 TTGAAGGAAAAAGAAGAGAAGGG - Intergenic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1106449842 13:29870450-29870472 TTCAAGAAACAGGAGAAGACTGG + Intergenic
1106670091 13:31896140-31896162 TTGAAGAATGGGCAGGAGAAAGG + Intergenic
1106810198 13:33350879-33350901 ATCAAGAAATAGGAGGAGTATGG - Intergenic
1106916748 13:34524071-34524093 TTGAGGAAGCAGAAGCAGAATGG + Intergenic
1107015604 13:35706103-35706125 CTAAAGACACAGGAGGAGAAAGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107341864 13:39415935-39415957 TTGCAGAATCAGGACTAGAAAGG + Intronic
1107367287 13:39696355-39696377 CTGAAGAAAAAGCAGGAAAAAGG + Intronic
1107414542 13:40188537-40188559 CTGAAGCCACAGGAGGGGAAGGG + Intergenic
1107436555 13:40385501-40385523 GGGAAGGAAGAGGAGGAGAAGGG + Intergenic
1107604297 13:42042131-42042153 TGGAAGAAACAAGAGCAGATGGG - Intronic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108695005 13:52895536-52895558 CTGAAGACACAGGAGAGGAAGGG - Intergenic
1109129851 13:58570656-58570678 TTTAGGAAACTAGAGGAGAAAGG - Intergenic
1109143318 13:58744585-58744607 TTTATGAAATAAGAGGAGAAAGG - Intergenic
1109363363 13:61324826-61324848 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1110179024 13:72593213-72593235 TTGAAGAAACAAGAGGCCACAGG + Intergenic
1110408908 13:75182988-75183010 GGGAAGAAACAGGGAGAGAAGGG - Intergenic
1110422535 13:75329128-75329150 TTGAAGGAAGAGGGGAAGAAAGG - Intronic
1110455694 13:75688063-75688085 TGGAAGGCAAAGGAGGAGAAGGG - Intronic
1110469446 13:75842287-75842309 AGGAAGAAACAGGAGGCCAATGG - Intronic
1110541940 13:76715920-76715942 TTGAAGCAATATGTGGAGAAGGG + Intergenic
1110602457 13:77390453-77390475 GTGAAGAAATAGAAGGAGATGGG + Intergenic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1110848536 13:80217911-80217933 TAAAAGAGACAGGAGGAGTAGGG + Intergenic
1110875169 13:80500710-80500732 GTAAAGAAACCGGAGGACAATGG + Intergenic
1110999256 13:82157324-82157346 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
1111039734 13:82731046-82731068 TTGAATAAACCTGAGGACAATGG - Intergenic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1111477489 13:88771515-88771537 TTGAAGTAGAAGGAAGAGAAGGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111717473 13:91897049-91897071 TTGATGAAAAAGGAGGAGGAGGG - Intronic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112745318 13:102521002-102521024 TTGAAGACTGAGTAGGAGAAAGG + Intergenic
1113661927 13:112113624-112113646 TTGAGGAAAGAGGAGAGGAAGGG + Intergenic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1114083583 14:19220853-19220875 TGGCAGATACAGGAGGAGGATGG + Intergenic
1114708289 14:24750190-24750212 TAGAACTAACAGGTGGAGAAAGG + Intergenic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114733691 14:25021308-25021330 TTGCATAAACAGGAGAGGAAAGG - Intronic
1114913429 14:27230401-27230423 TTGAAGAGACAGTAGGTGGAAGG + Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115709964 14:36039769-36039791 TAGAAGAGTGAGGAGGAGAAAGG + Intergenic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116059596 14:39905130-39905152 TTGAAGAAACAAGCTGAAAATGG - Intergenic
1116780086 14:49227564-49227586 TTTAAGAAAGAGAGGGAGAATGG - Intergenic
1117091395 14:52254376-52254398 ATGAAGAATTAGGAGAAGAATGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117496784 14:56313388-56313410 TGGAAGACAAAGGAGGAGCAAGG + Intergenic
1118019678 14:61697172-61697194 TTGAAGAAGGACCAGGAGAAGGG - Intronic
1118898598 14:69967828-69967850 GAGAAGCAACAGGAGTAGAAGGG - Intronic
1119441213 14:74630008-74630030 CTGAAGAAAAAGGAGGCCAAGGG + Intergenic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120017205 14:79487554-79487576 TTGGGGAAACAGGAAGAAAAAGG - Intronic
1120051604 14:79873512-79873534 TGGAAGAATGAGGAAGAGAAAGG - Intergenic
1120286545 14:82509462-82509484 TTGAGGATACGGGATGAGAAAGG + Intergenic
1120601320 14:86513701-86513723 TCGAAGAGACAGGAAGAAAAGGG + Intergenic
1120713102 14:87813569-87813591 TTGAAGAAACAGGTGCAGAGAGG - Intergenic
1120802578 14:88708483-88708505 TTGAAGAAAGAGAAAAAGAAAGG + Intronic
1120808369 14:88776992-88777014 ATAAAGAGACAGGAGTAGAAAGG + Intronic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1121389833 14:93564503-93564525 TTGAAGGAGCAGGAGGACAGGGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121835984 14:97092830-97092852 TTGTACAAAGAGGAGCAGAACGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122242261 14:100376599-100376621 CTGAAGGAACAGGAAGTGAAAGG - Exonic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1202895194 14_GL000194v1_random:2622-2644 TGGCAGATACAGGAGGAGGATGG + Intergenic
1123933405 15:25182688-25182710 TGAAAGACACAAGAGGAGAACGG - Intergenic
1125333564 15:38605511-38605533 TAGAAAACAGAGGAGGAGAAAGG - Intergenic
1126103248 15:45132179-45132201 TTGAAGAAATAGATGGATAATGG + Intronic
1126355935 15:47795969-47795991 TTGAAGTAAAAGGGGGAAAATGG - Intergenic
1126429984 15:48572908-48572930 TTTAAAAAACAAGAGGCGAAGGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126733994 15:51713380-51713402 TTGAAGAAACATGACAAAAAGGG + Exonic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127485164 15:59412030-59412052 GTGAAGAGAAAGGGGGAGAATGG + Intronic
1127489832 15:59452107-59452129 CTGAAGAATCAGGAAGAGATGGG - Intronic
1127978040 15:64013511-64013533 TTAAGAAAACATGAGGAGAAGGG + Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128341256 15:66824011-66824033 ATGAAGAGAGAGAAGGAGAATGG + Intergenic
1128761021 15:70216078-70216100 TTGAAGAAACAGGCCCAGAGAGG + Intergenic
1128868323 15:71133280-71133302 TTTCAGAAACAGCAGAAGAATGG + Intronic
1130204970 15:81867327-81867349 ATCCAGAGACAGGAGGAGAAAGG + Intergenic
1130435808 15:83898293-83898315 TTGAAGAAAAAGAAGAAGAATGG + Intronic
1131438974 15:92444460-92444482 TGGCAGAAAAAGGAGGAGAAAGG + Intronic
1131451632 15:92545303-92545325 TAAAAGTAACAGGATGAGAAAGG + Intergenic
1131468837 15:92677982-92678004 ATAAAGAAATAAGAGGAGAAAGG - Intronic
1131687087 15:94779755-94779777 TTTTGGAAAGAGGAGGAGAAAGG + Intergenic
1131888664 15:96948125-96948147 TGAAAGGATCAGGAGGAGAAGGG - Intergenic
1132088865 15:98931139-98931161 TTGAGAAGTCAGGAGGAGAATGG + Intronic
1132134295 15:99319346-99319368 TTGAAGAATGAGGAAGATAAAGG + Intronic
1132659552 16:1055292-1055314 CTGAAGAATCAGGCGGAGCACGG - Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133791792 16:9014711-9014733 CTGAAGAAAGAAGAGGAGAATGG - Intergenic
1133885736 16:9825962-9825984 TGGAAGGAGTAGGAGGAGAAGGG + Intronic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134148791 16:11789147-11789169 TTGAAGGAAGAGGGGGTGAAGGG + Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134775202 16:16846927-16846949 TAGAAGAAAAAGGCGGAAAAAGG + Intergenic
1134776672 16:16859372-16859394 TTGACCAATTAGGAGGAGAAAGG + Intergenic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135004468 16:18806712-18806734 TTAAAGAAAGTGGAGGAGAGGGG + Exonic
1135105708 16:19647369-19647391 TTGAAGAAATAGGAGAAGAGAGG + Intronic
1135168759 16:20164674-20164696 TGGAAGAAAGAGGAGGGAAAGGG - Intergenic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1136045921 16:27614858-27614880 TACAGGGAACAGGAGGAGAAAGG + Intronic
1136676651 16:31914585-31914607 TTTAAGAAAAAGGTGGAAAAGGG + Exonic
1137850294 16:51735147-51735169 TTAAAGAAGTAGGAGAAGAAAGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138011112 16:53380973-53380995 TTGAAGAAATGGAAGGAGAAAGG - Intergenic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138894810 16:61190751-61190773 GGGAAGAAAAAGAAGGAGAAGGG - Intergenic
1138894817 16:61190781-61190803 GGGAAGAAAAAGAAGGAGAAGGG - Intergenic
1139134607 16:64186931-64186953 TTGAAGAAACAGCAGCTGATAGG + Intergenic
1139273373 16:65704159-65704181 CTGAAGGCAGAGGAGGAGAAAGG - Intergenic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140331782 16:74064689-74064711 TTAAAAAAACAGAAGGTGAAGGG + Intergenic
1140592444 16:76369883-76369905 TAGAACAAAACGGAGGAGAAAGG - Intronic
1141116228 16:81312207-81312229 TTGAAGTAACTGGAGGTGAATGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141696961 16:85624727-85624749 TGGAATAAACAGGTGGAGAGAGG + Intronic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144319594 17:14101303-14101325 ATGAAGAGAAAGGAAGAGAATGG - Intronic
1144348918 17:14375574-14375596 AAGAAGGAAGAGGAGGAGAATGG - Intergenic
1144353215 17:14419315-14419337 TTGAAAAAATAGGAGGATATAGG + Intergenic
1144377199 17:14656241-14656263 TTGAAAAATCAGGGAGAGAAAGG - Intergenic
1144495134 17:15741159-15741181 TGGCAGACACAGGAGGAGGATGG - Exonic
1144518960 17:15941779-15941801 TTCAGGAAACACGAGGAGGAAGG - Intergenic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144644070 17:16957391-16957413 TAGAAGTTACAGAAGGAGAAGGG + Intronic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145244420 17:21258884-21258906 TTTAAGTCACAGGATGAGAAAGG + Intergenic
1145343272 17:21972490-21972512 TTGAATAAACAAGAGTGGAATGG + Intergenic
1145344208 17:21978586-21978608 TTGAATAAACAAGAGTGGAATGG + Intergenic
1145735885 17:27231435-27231457 TCGAAGACAGAAGAGGAGAAGGG + Intergenic
1145751909 17:27361334-27361356 TCATAGAAAGAGGAGGAGAACGG + Intergenic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147507617 17:41035108-41035130 TTTAAGAAACATGAGGAGTTAGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1148973971 17:51510602-51510624 TTGAAGAAACAGGTGAGGAAAGG - Intergenic
1149014100 17:51888178-51888200 TTTAAAAAAAAGGAGAAGAAAGG + Intronic
1149037483 17:52151430-52151452 TTGTAGATACAAGTGGAGAAGGG - Intronic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1150162095 17:62907137-62907159 TAGAAGGAACAGCAGGAGAAAGG + Intergenic
1150506484 17:65703708-65703730 TGGAAGTAATAGCAGGAGAATGG - Intronic
1150582464 17:66487182-66487204 GGGAAGAAAAAAGAGGAGAAAGG - Intronic
1150583685 17:66498462-66498484 GGGAAGAAAAAGGAAGAGAAGGG - Intronic
1150880425 17:69019475-69019497 TTGAAGAAGAGAGAGGAGAATGG - Intronic
1151561005 17:74869521-74869543 GTGAACAAAGAGGAAGAGAATGG - Intronic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1153122689 18:1749291-1749313 TTTAACAAACAGGAGGACAGTGG + Intergenic
1153187859 18:2504947-2504969 TTGACAAAACAAAAGGAGAATGG + Intergenic
1153817073 18:8799881-8799903 TGGAAGAAGCAGGAGGCAAAGGG - Intronic
1153974964 18:10261266-10261288 TTGAAGAAGAAAGAGGTGAATGG - Intergenic
1154078422 18:11229046-11229068 TGGGGGAAACAGGAAGAGAAGGG + Intergenic
1154312336 18:13277024-13277046 GGCAGGAAACAGGAGGAGAAAGG + Intronic
1154500262 18:14992515-14992537 TGGCAGATACAGGAGGAGGATGG + Intergenic
1155050949 18:22147281-22147303 TTGTACAATGAGGAGGAGAAGGG + Intergenic
1155136382 18:22997698-22997720 ATGAAGAAGCAAGAGCAGAAGGG + Exonic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155924393 18:31639161-31639183 TTAAACTAACAGGAGGATAAAGG + Intronic
1156133594 18:34008091-34008113 TAAAAGAAAGAGGTGGAGAAAGG + Intronic
1156225611 18:35103899-35103921 TTGAGGAAAAAGTTGGAGAAAGG + Intronic
1156261300 18:35446923-35446945 TTGGAGAACCAGGAGGTGAGGGG - Exonic
1156421554 18:36959594-36959616 GTCCAGGAACAGGAGGAGAAAGG - Intronic
1156584113 18:38412974-38412996 TTCAAGAAACAAGCAGAGAAAGG + Intergenic
1156696132 18:39770484-39770506 TTTAAAAGACAGGAAGAGAAGGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157570257 18:48707574-48707596 GAGAAGGAAGAGGAGGAGAAGGG - Intronic
1157805323 18:50653630-50653652 TGGAAGGAAGCGGAGGAGAATGG + Intronic
1158172451 18:54614877-54614899 TTGAAGAGGCAGGAGGGGACGGG + Intergenic
1158295162 18:55988539-55988561 TGGAAGAAACAGGACCAGAGAGG - Intergenic
1158508299 18:58066789-58066811 TGGAAGAATCAGGAGGAAGAGGG + Intronic
1158699068 18:59730314-59730336 TTTAAGAATAAGGAGGGGAAAGG - Intergenic
1159053675 18:63444532-63444554 TTGAATAAACAGGAAAAAAAAGG - Intergenic
1159069808 18:63611178-63611200 TTGAAGCAAAAGGAATAGAAAGG - Intergenic
1159375653 18:67589191-67589213 TTTAAAAAACAGGAAGAGAAAGG - Intergenic
1159444701 18:68527407-68527429 TTGTAGCAACAGGAGAAAAAAGG + Intergenic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1160142181 18:76335526-76335548 AAAAAGAAAGAGGAGGAGAAAGG + Intergenic
1160432318 18:78820115-78820137 ATGGAGAAACAGGGGGAGAGAGG + Intergenic
1161149641 19:2701308-2701330 TTGACTAATCAGGAGGAAAACGG - Intronic
1161803568 19:6429606-6429628 GTGAGAAAAAAGGAGGAGAAAGG + Intronic
1163050208 19:14677495-14677517 TAGAGGAGACAGGACGAGAATGG + Intronic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1164441709 19:28284519-28284541 AAGAAGAAAGAGGAGAAGAAGGG + Intergenic
1164567632 19:29339323-29339345 GAGAAGAAACAGGGGGAGAGAGG - Intergenic
1164841453 19:31395937-31395959 AAGAAGAAAAAGGAGGAGAATGG + Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165390204 19:35534343-35534365 TGGAAGACACAGGAGCAGACAGG + Intronic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165950503 19:39471656-39471678 TGCAAGAAACTGGTGGAGAACGG + Exonic
1167251820 19:48402896-48402918 TTGAATAAAAAGGAGGATAGGGG + Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167580122 19:50336509-50336531 TTGAAGTAAAAGGAGAAGACAGG + Intronic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
1168245436 19:55110940-55110962 GGAAAAAAACAGGAGGAGAAAGG + Intronic
1202710782 1_KI270714v1_random:18407-18429 GCGAAGAAAAAGGAAGAGAAGGG - Intergenic
925025720 2:605851-605873 TAGAAGGAAAAGGAGGAGGATGG + Intergenic
925032535 2:661798-661820 GTGAAGTAACATGATGAGAATGG - Intergenic
925299611 2:2801288-2801310 TGGAAGGCAAAGGAGGAGAAAGG - Intergenic
925539177 2:4948368-4948390 TTTAAGAAAAGGGAAGAGAAGGG - Intergenic
925597313 2:5568556-5568578 GAGAAGAAAGAAGAGGAGAAAGG + Intergenic
925674550 2:6347094-6347116 TTTATGAAACAGCAGGTGAAAGG + Intergenic
925749760 2:7077378-7077400 TTGGAGAAAAAGGAGCAGAAAGG + Intergenic
925787093 2:7442368-7442390 GTCAAAAAACAGGAGGAGATGGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926156391 2:10456407-10456429 TAGAAGAAAGGAGAGGAGAATGG + Intergenic
926543325 2:14208007-14208029 CAGAAGAAAAAAGAGGAGAAAGG + Intergenic
926962902 2:18378311-18378333 ATGAGGAGTCAGGAGGAGAATGG + Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
927561017 2:24073791-24073813 TTGAGGAAACTGGTTGAGAAGGG - Intronic
927899997 2:26812292-26812314 TTGAGGGCACAGGAGGAGTATGG - Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928358632 2:30644911-30644933 TTTAAGCAAAAGGAAGAGAAGGG + Intergenic
928936266 2:36681764-36681786 TTCCAGAAATAGAAGGAGAAAGG + Intergenic
929357391 2:41042104-41042126 TTGGAGAAAGATGGGGAGAATGG - Intergenic
929532016 2:42758720-42758742 TTTTAAATACAGGAGGAGAAGGG - Intergenic
929555746 2:42924697-42924719 TTGAAGAAAGACGGGGAGAGGGG - Intergenic
930166183 2:48205825-48205847 CGGAAGGAACAGGAGGAGAAGGG + Intergenic
930272604 2:49274367-49274389 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
930533110 2:52614693-52614715 TAGAATAACCAGGAAGAGAATGG + Intergenic
930783083 2:55242636-55242658 GTAAAGAACCAGGAGGAGTAGGG + Intronic
930932913 2:56910093-56910115 TAGACAAAACAAGAGGAGAATGG - Intergenic
931801059 2:65757977-65757999 TGGAAGGCAAAGGAGGAGAAAGG + Intergenic
932107334 2:68956764-68956786 GTGAAGAAAGAGCAAGAGAAAGG - Intergenic
932321193 2:70823198-70823220 TTCAACAAACAGGAGGTAAAAGG - Intergenic
932388316 2:71359369-71359391 TCCAAGAACAAGGAGGAGAAGGG + Intronic
932549023 2:72747732-72747754 TAGAAGCAAAAGGAGAAGAATGG - Intronic
932808427 2:74803407-74803429 TTGAAGACTTAGGAGGAGAGAGG + Intergenic
932907774 2:75772306-75772328 TTTAAGAACAAGGAGGAGAGGGG + Intergenic
933073170 2:77888275-77888297 TTGATAAATCAAGAGGAGAAGGG + Intergenic
933267018 2:80191524-80191546 GTGAAGAAAAAGGTGAAGAAGGG - Intronic
933743174 2:85550930-85550952 TTAAAGGAAAAGGTGGAGAATGG - Exonic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934558495 2:95300088-95300110 AAGAAGACGCAGGAGGAGAAGGG + Intronic
935536864 2:104304959-104304981 TTGAAGAAAAGGCATGAGAAGGG - Intergenic
935662199 2:105476699-105476721 TTGAAAAAACAGAATGATAATGG + Intergenic
936475736 2:112838078-112838100 TGGAGGAACCAGGAGGAGCAAGG - Intergenic
936724497 2:115296484-115296506 TTGAAGAGAGAGCAGGGGAATGG + Intronic
937816579 2:126257543-126257565 TTGATGAAACAGCGGGAGAGTGG - Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938079910 2:128364483-128364505 TGGAAGGAGCAAGAGGAGAAGGG - Intergenic
938189093 2:129258163-129258185 TTGAAGAATGAGGTAGAGAATGG + Intergenic
938493005 2:131775780-131775802 TGGCAGATACAGGAGGAGGATGG - Intergenic
939232134 2:139442130-139442152 TTTAAGTAACAGGATGAGAAAGG - Intergenic
939371817 2:141311375-141311397 TTGAAGATACAGTAGGATACTGG + Intronic
939447874 2:142333717-142333739 TGGAAGATACAGGAGGAAACTGG + Intergenic
939496113 2:142930402-142930424 TTCCAGAAAAGGGAGGAGAAAGG + Intronic
939747227 2:145990004-145990026 GTGAAGAAATATGAGGTGAAAGG - Intergenic
939839287 2:147167963-147167985 TTGAAGAATCAAGAGAATAAGGG - Intergenic
940382011 2:153025727-153025749 TTCAAGAAAGGGGAGAAGAAAGG - Intergenic
940406459 2:153308800-153308822 TTAAAGAATCATGAGTAGAATGG + Intergenic
940570509 2:155427140-155427162 ATGAAGAAATAAGAGGACAAAGG + Intergenic
941271704 2:163438179-163438201 AGAAAGAAAGAGGAGGAGAAAGG + Intergenic
941776259 2:169396673-169396695 TGGAAGGAGGAGGAGGAGAAGGG + Intergenic
941824575 2:169879942-169879964 TTGAAGATAGGGGAGGGGAATGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942069318 2:172301183-172301205 TGGAAGAAAAAGAAAGAGAAGGG - Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942342641 2:174964337-174964359 TCCTAGAACCAGGAGGAGAAAGG + Intronic
942985402 2:182134740-182134762 ATGATGAAGGAGGAGGAGAAAGG + Intergenic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
943528368 2:189047399-189047421 TTGAAAAAAAAGGGGAAGAAAGG - Intronic
943682427 2:190782562-190782584 CTGAAGTAAGAGGAGGAAAAGGG - Intergenic
943869250 2:192972969-192972991 TAGAAGAAACACCATGAGAAAGG - Intergenic
944404729 2:199370707-199370729 TTGAAGATATAGCAGGAGCAAGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944541608 2:200758786-200758808 TTGAATAAAGAGTGGGAGAATGG + Intergenic
944678736 2:202056388-202056410 TTGAAGAAACAGGTACTGAATGG - Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
945373347 2:209049020-209049042 GAGAAAAAACTGGAGGAGAATGG + Intergenic
945639375 2:212404262-212404284 TTGAAGAAAGAGGAGGAAAAAGG - Intronic
945711352 2:213300236-213300258 GAGAAGAAAGAGGAGGAAAAGGG - Intronic
945735319 2:213591747-213591769 AAGAAGAAACATGAGGAGTAAGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946771388 2:223092472-223092494 CTGAAGAAACTGGAGCTGAAGGG - Intronic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947046879 2:225997608-225997630 TTGAAGAATCTGGTGGAGAATGG - Intergenic
947258444 2:228192539-228192561 TAAAAAAAACAGGAGGACAAGGG - Intergenic
947476246 2:230450065-230450087 AAGTAGAAACAGGAGAAGAAAGG + Intronic
947587115 2:231363214-231363236 TTGATGAACAAGTAGGAGAAAGG + Intronic
947745936 2:232507370-232507392 TGGAAGAAAAAGGAGGTGCAGGG - Intergenic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
948226327 2:236311903-236311925 GAGAAGAAATAGGAGGAAAAGGG - Intergenic
948726469 2:239937060-239937082 TTGACGAATCAGGAGCAGAGGGG + Intronic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169631324 20:7635643-7635665 TTTAAAAATGAGGAGGAGAATGG - Intergenic
1170059513 20:12244684-12244706 GTGGAGAATGAGGAGGAGAAAGG - Intergenic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1172044493 20:32070883-32070905 ACGAAGAAAGAGGAGGAGGAGGG + Intronic
1172274316 20:33671502-33671524 TTGAAGAGACCCAAGGAGAAGGG + Intronic
1173240992 20:41297142-41297164 TTGAATCAACACAAGGAGAATGG + Intronic
1174215820 20:48915411-48915433 TTTAAGAAAGAAGAGGAAAATGG + Intergenic
1174724733 20:52849746-52849768 TTGGTGAAAGAGGAGGAAAAAGG + Intergenic
1175723246 20:61300284-61300306 TTGAAAAATGAGCAGGAGAAGGG + Intronic
1175764333 20:61582325-61582347 TTGAACAATAAGGAGGAGAGCGG - Intronic
1176614896 21:9018609-9018631 TGGCAGATACAGGAGGAGGATGG + Intergenic
1176710314 21:10145262-10145284 TGGCAGATACAGGAGGAGGATGG - Intergenic
1176949601 21:15029469-15029491 TTGAAGCAAAGAGAGGAGAATGG - Intronic
1177501169 21:21956952-21956974 CTGAAAAAAAAGGAGGAAAAAGG - Intergenic
1177751499 21:25290524-25290546 TTTAACAAACAGTAAGAGAATGG + Intergenic
1177861861 21:26463725-26463747 TTGAACCAACAGGAGCAGAATGG - Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178243353 21:30927765-30927787 TGCAAGAGACAGAAGGAGAAAGG + Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178438371 21:32579125-32579147 TTGAAGACACAGGAGCCTAAAGG - Intronic
1179398063 21:41059478-41059500 GGTAAGAAAAAGGAGGAGAAAGG + Intergenic
1179626453 21:42652307-42652329 TTCAAGTGACAGGATGAGAAGGG - Intergenic
1180294393 22:10872414-10872436 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180497199 22:15901828-15901850 TGGCAGATACAGGAGGAGGATGG - Intergenic
1181180431 22:21064116-21064138 TTCCAGAAACAGGAAGATAATGG - Intronic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1182126825 22:27821927-27821949 TTGAAGGAACAGGATGTGAGGGG - Intergenic
1182394542 22:30025997-30026019 TTGAAGGCAGAGGAGGAGGATGG - Exonic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1183300381 22:37056249-37056271 TGGAGGGAACAAGAGGAGAATGG + Intronic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
1183942371 22:41302633-41302655 TTGAGGAGAAAGGAGGGGAAAGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184618423 22:45654336-45654358 GTGAAGGAACAGGAGGAAACTGG - Intergenic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1185236770 22:49718388-49718410 AGGAAGAAAAAGGAGAAGAAAGG - Intergenic
949323686 3:2840362-2840384 GAGGAGAAAGAGGAGGAGAAGGG - Intronic
949462995 3:4314043-4314065 AGGAAGAAAGAGGAGGTGAAGGG - Intronic
949494856 3:4621846-4621868 TTGGAGTTGCAGGAGGAGAAAGG - Intronic
949932643 3:9091214-9091236 TTGATGAGACAGGAGAAGAGAGG - Intronic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950664237 3:14485534-14485556 TGGAAGAAATAGCAGGAGAGAGG + Exonic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951169824 3:19528072-19528094 TGGAAGAATAAGAAGGAGAAGGG + Intronic
951682213 3:25306519-25306541 TAGAAGAAAAAGAAGAAGAAAGG + Intronic
952077297 3:29712701-29712723 TAGAACAAAAAGGTGGAGAAAGG + Intronic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952893865 3:38063811-38063833 ATGAAAAAAGAGGGGGAGAAAGG - Intronic
953862925 3:46560798-46560820 ATGATGAGACAGAAGGAGAACGG + Intronic
953916381 3:46923444-46923466 TGGGAGAAAGAGGAGGAGGAAGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
954156291 3:48686466-48686488 CTGAAGAGAGAGGAGGAGTAGGG - Intergenic
954598146 3:51845268-51845290 TTTAAGAAACAGGGCCAGAAAGG + Intergenic
954807292 3:53228043-53228065 CTGAAGAAAGGTGAGGAGAAGGG - Exonic
954893521 3:53955082-53955104 TTTAAATAACAGGAGGAAAATGG + Intergenic
955055397 3:55450736-55450758 TTGAAGAAAGGAGAGAAGAAAGG - Intergenic
955148388 3:56342761-56342783 TTGAAGAAAGAGGAATACAATGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
955821785 3:62903867-62903889 TTAAACAATCAGGAGGAGAATGG - Intergenic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
956514517 3:70032245-70032267 TCAAGCAAACAGGAGGAGAAGGG + Intergenic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
957314924 3:78564692-78564714 TGCCAGAAACAGTAGGAGAAAGG + Intergenic
957435430 3:80168899-80168921 TGGAAGGCAAAGGAGGAGAAAGG + Intergenic
957442912 3:80274665-80274687 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
959163897 3:102752915-102752937 TTGAAGGAACATGAGCTGAAGGG + Intergenic
960391710 3:117084825-117084847 AGGAAGAAAAAGCAGGAGAAAGG - Intronic
960474547 3:118108008-118108030 TTCAACACACAGGAGGAAAAAGG + Intergenic
960526318 3:118715094-118715116 TGGAAAAACAAGGAGGAGAAAGG - Intergenic
960726029 3:120671084-120671106 CTGAAGAAACTGGAGGACGAAGG - Intronic
960908726 3:122627255-122627277 GTAAATAAACAGGAAGAGAATGG + Intronic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961491566 3:127259965-127259987 GAGAAGAAAGAGGAGGAAAAGGG - Intergenic
962100178 3:132333618-132333640 TTCAAGAAACAGCAGAAAAATGG - Intronic
962134342 3:132718510-132718532 CTGAAGAAAGAAGAGGAGAATGG - Intronic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
963106722 3:141653785-141653807 TGGCACCAACAGGAGGAGAAAGG - Intergenic
963562674 3:146885875-146885897 TGAAAGAGAAAGGAGGAGAAGGG + Intergenic
963592578 3:147280904-147280926 GGGAAGGAAAAGGAGGAGAAAGG + Intergenic
963843771 3:150134127-150134149 TAGAAGGCAAAGGAGGAGAAAGG - Intergenic
964149023 3:153501502-153501524 TGGAAGAAACATGACTAGAAAGG + Intronic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
964805439 3:160604879-160604901 TTGAAGACCCAGGGGGAAAAAGG - Intergenic
965348213 3:167578538-167578560 TGGGAGAAATGGGAGGAGAAAGG - Intronic
965494350 3:169379353-169379375 TTGAAGGAGAAAGAGGAGAAAGG + Intronic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
965863040 3:173170148-173170170 TTAAAGAAGCAGGAAGGGAAGGG + Intergenic
965935624 3:174106862-174106884 TAGAAGAAAAAAAAGGAGAAAGG - Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966661697 3:182421703-182421725 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
966781160 3:183585506-183585528 TTATAGAGATAGGAGGAGAAAGG + Intergenic
967048904 3:185763953-185763975 TCCAAGAAACAGCAGCAGAACGG - Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967259219 3:187625625-187625647 GTGAAAAAACGGCAGGAGAAAGG - Intergenic
967473114 3:189886066-189886088 TTGAAGGGAAAAGAGGAGAAGGG + Intronic
967626686 3:191694117-191694139 TAGAAGAAACCTGAGGAGCATGG + Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968531541 4:1094455-1094477 AGGAAGAAACAGGTAGAGAATGG + Intronic
969176258 4:5401076-5401098 CTGCAGAAACAAGAGGGGAATGG + Intronic
969177382 4:5408935-5408957 TTAAAGAAATAGGAAGACAATGG + Intronic
970155902 4:13141595-13141617 TAGAAGGCAAAGGAGGAGAAAGG + Intergenic
970291121 4:14573375-14573397 GTGAAGACACAGGAGGAAGATGG + Intergenic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971104112 4:23502654-23502676 TTGAAGTAACAAGAGAACAATGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971531972 4:27700417-27700439 AAAAAGAGACAGGAGGAGAATGG + Intergenic
971592231 4:28482791-28482813 TTGGAGTCACAGGAGAAGAATGG + Intergenic
971876322 4:32313571-32313593 TTGCAGACACAGAAGGACAATGG + Intergenic
973109959 4:46386302-46386324 TTAAAAAAAAAGGAGGAAAACGG - Intronic
974177448 4:58342744-58342766 TTGTAGAATCTGGAGGAGATGGG + Intergenic
974405309 4:61460693-61460715 TGGAAGGCAAAGGAGGAGAAAGG + Intronic
974705951 4:65515875-65515897 TAGAACAAAAAGGAGGAGAAAGG + Intronic
974778817 4:66524634-66524656 TTGAAGAAATAAGAAAAGAAAGG - Intergenic
975257892 4:72259956-72259978 TTGAGGAAACAAGAAGATAAAGG + Intergenic
975433912 4:74328644-74328666 TTGAAGCATCATGTGGAGAAAGG + Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976439444 4:85056334-85056356 GTGAAGAAAGAGGTGGAGAAAGG - Intergenic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
977054349 4:92171456-92171478 TTAAAGAAACAGCAGCATAATGG + Intergenic
977149554 4:93492932-93492954 TCGTAGAAGCAGGAGTAGAATGG - Intronic
977150021 4:93499582-93499604 TGGAAGATACCGGAAGAGAAGGG - Intronic
977409001 4:96637336-96637358 TAGAAGAAAAAGAAGAAGAAAGG + Intergenic
977583841 4:98753476-98753498 TGGAAAATACAGGAGGAAAAGGG + Intergenic
977940405 4:102851609-102851631 TTAAAGGAAGAAGAGGAGAAAGG - Intronic
977984333 4:103363933-103363955 ATTATGAAACAAGAGGAGAAGGG + Intergenic
978021244 4:103815511-103815533 ATGAAGAAAAAGGAGAAGGAAGG - Intergenic
978225204 4:106325031-106325053 CTGAAGAGACTGGAGCAGAAGGG + Exonic
978225705 4:106332291-106332313 TTGAGGAAAAATGAGGAGAGGGG - Intronic
978843994 4:113250437-113250459 TTGATAAAACGGGAGGAAAAAGG - Intronic
978850669 4:113332110-113332132 TTGCAGAAGAAGGAGAAGAATGG - Intronic
979147954 4:117269591-117269613 TTGAAGAAACAGTTGGAAAATGG + Intergenic
979205862 4:118037138-118037160 TTGAACAAACAGGATAAAAAAGG - Intronic
979255261 4:118601875-118601897 GGGAAGAAAAGGGAGGAGAAGGG - Intergenic
979333075 4:119438637-119438659 GGGAAGAAAAGGGAGGAGAAGGG + Intergenic
979709517 4:123761771-123761793 TTGATGACAGAAGAGGAGAAGGG + Intergenic
979757519 4:124360606-124360628 TTAAAGAAACAAGAGAAGGAGGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980235468 4:130099414-130099436 TTGCAGAGACAGGAGGGCAAGGG - Intergenic
980271146 4:130585038-130585060 ATGAAGAAACAAGAGTTGAATGG + Intergenic
980279477 4:130700891-130700913 TTGATGAAGCAGGAAGAAAACGG + Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981041900 4:140230866-140230888 TAGAACAAAAAGGAGGAGAAAGG - Intergenic
981141505 4:141274966-141274988 TTGAAGAAAGAGGAACAGACAGG - Intergenic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
981437341 4:144740933-144740955 TGGCAGAAACAGTAGTAGAAAGG - Exonic
981515005 4:145598125-145598147 TTGAAGAAAAACTAGGAAAAAGG - Intergenic
981598046 4:146449434-146449456 CTGAAGGAACAAGAGGAGCAGGG + Intronic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982335206 4:154228857-154228879 TTGCAGAAACAAAAGAAGAAGGG - Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982580395 4:157170678-157170700 TTGAAGAACAAGAAGCAGAAAGG - Exonic
983018397 4:162643326-162643348 TTGGAGAAATTGGAGGAGATTGG + Intergenic
983594424 4:169449927-169449949 TTGAAGAAAGATTAGAAGAATGG + Intronic
983892563 4:173045744-173045766 TCCAAGAAACATGAGAAGAACGG - Intergenic
984128382 4:175840820-175840842 TTGAAGAATGAACAGGAGAACGG + Intronic
984227204 4:177050069-177050091 TTGAAGAAAAAGGCTAAGAAGGG - Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
986797222 5:11223840-11223862 TAGGAGGAAAAGGAGGAGAAAGG + Intronic
987044921 5:14099033-14099055 TTGCAGAGACAAGAGGAGAATGG - Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
987567248 5:19606562-19606584 CTGAACAAACAGCAGAAGAAAGG + Intronic
987581152 5:19794341-19794363 TAGAAGAAAAAGATGGAGAAAGG + Intronic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
987941412 5:24543821-24543843 CTGAAGAAAAATGAGGAGAATGG + Intronic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988671131 5:33383127-33383149 TTGAAGAAACAGCAGAAAAAAGG + Intergenic
989024176 5:37046794-37046816 ATGAGGAAATAGGAGGTGAATGG + Intronic
989242788 5:39219679-39219701 TTGAGTAATAAGGAGGAGAAAGG + Intronic
989300547 5:39886985-39887007 ATCAAGAAAGAGGAGCAGAAAGG - Intergenic
989313614 5:40051002-40051024 TTGAAAAAACATCAGGAAAATGG + Intergenic
989669987 5:43905532-43905554 TAGCAGACACAGGAGGAGAAAGG - Intergenic
989750839 5:44891332-44891354 TTGATGAAACTGGAGGACATTGG - Intergenic
989788550 5:45362889-45362911 TTCAAGAAACTGGTTGAGAAAGG - Intronic
989910999 5:49656575-49656597 TGGAAGAAACACGAGTGGAATGG - Intergenic
989960569 5:50409672-50409694 TTAAGGAAAGAGGAGGGGAAGGG + Intronic
989976126 5:50589065-50589087 TTGAAGAGAGTGTAGGAGAAAGG - Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990260484 5:54016551-54016573 TTAAAGACAAAGGAGCAGAAAGG - Intronic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990777647 5:59321167-59321189 TTGGTGGAACAGGAGCAGAAAGG - Intronic
991333985 5:65526218-65526240 TTGAAAAAAATGGAGGAGACTGG + Intronic
991503365 5:67299849-67299871 TTAAAGGCAAAGGAGGAGAAGGG + Intergenic
992021609 5:72630339-72630361 ATCAAGAAACAGGTGGTGAAGGG - Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992031830 5:72728845-72728867 TTGAAAAAAGATGAGAAGAATGG + Intergenic
992326106 5:75661802-75661824 TTGAAAAGAAAGGAGAAGAAGGG - Intronic
992472315 5:77070171-77070193 TTGGAGAATGAGGAGGAGATTGG + Intergenic
992634656 5:78715907-78715929 TTAAAAAAACAGGACAAGAATGG + Intronic
992701480 5:79345571-79345593 TTGAGTAAATAGGAGTAGAATGG + Intergenic
992905874 5:81345141-81345163 TCTAAGCAACAGGAGGATAAGGG + Intronic
993023881 5:82624488-82624510 TTGAAGGAACCGAAGTAGAATGG + Intergenic
993329791 5:86584424-86584446 TAAAAGAAACATGAGGGGAAGGG + Intergenic
993717729 5:91292076-91292098 TTTAAGACACAGGATGAGATAGG - Intergenic
993824632 5:92667628-92667650 TTGAAGAAAAAAGAAGAGAATGG - Intergenic
994082079 5:95718272-95718294 TTGAAGACAGGGGAGAAGAAAGG + Intronic
994159135 5:96536055-96536077 TTAAAGAAAAAGGAGGAGGAGGG + Intronic
994814782 5:104571307-104571329 TTTAAGAAACAGGCAAAGAACGG - Intergenic
994832186 5:104798835-104798857 TTGAAGAAAAAAGAGGAAGATGG - Intergenic
995148373 5:108811860-108811882 TGGAACAAAAAGGAGGAGGAAGG - Intronic
995206363 5:109485849-109485871 TTGAAGAAACACCAGATGAAAGG + Intergenic
995483347 5:112614627-112614649 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
995602209 5:113809965-113809987 TTGAAGACAGAGGAGGTGAAGGG - Intergenic
995653999 5:114403773-114403795 TGACAGAAACAGGAGGAAAAAGG + Intronic
995924396 5:117353328-117353350 TTGACAAAACAGAAGAAGAAGGG + Intergenic
996300805 5:121982096-121982118 TATCAGAAACAGGAGGAAAAAGG + Intronic
997453329 5:134000666-134000688 CTGAAGAAAAAGGAGTAGAGAGG - Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1000181571 5:158816791-158816813 CTGAAAAAAAAAGAGGAGAAAGG + Intronic
1000581882 5:163044999-163045021 TTCCAAAAACATGAGGAGAAGGG + Intergenic
1000894202 5:166835508-166835530 AAGAAGGAAGAGGAGGAGAAAGG + Intergenic
1001197872 5:169690013-169690035 TTATGGAAACAGGATGAGAAAGG - Intronic
1001261141 5:170230045-170230067 ATGAACAGACAGGAGGAAAATGG + Intergenic
1001272032 5:170320102-170320124 TTGAAGACAGAGGAAGAGACTGG - Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1002384511 5:178856243-178856265 TAGAAGACTCAAGAGGAGAAGGG + Intergenic
1002453780 5:179334039-179334061 GTTAAGACACAGGAGGAGAATGG + Intronic
1002906001 6:1449681-1449703 TTGAAGGAAGAAGAGGCGAAAGG + Intergenic
1002941630 6:1721873-1721895 TTTCAGAAACAGGATCAGAAAGG + Intronic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003024059 6:2537753-2537775 TTGAGAAAACAGAAGCAGAAAGG - Intergenic
1003152016 6:3560724-3560746 TTTAAGAAAGAAGGGGAGAATGG + Intergenic
1003204426 6:3994007-3994029 TTGAATCAAAAGGATGAGAAAGG + Intergenic
1003219645 6:4147634-4147656 TTATAGAAACAGGAATAGAATGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004092049 6:12513693-12513715 TGGAAGAAGCAGGAGGATAGAGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005025315 6:21457722-21457744 TTGATGAAAAAGGAAGAAAAGGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006142874 6:31941368-31941390 TTGAAGACAGAGGCAGAGAATGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006650191 6:35545037-35545059 GTGAAGCAAGAGGAGGAGGAGGG + Intergenic
1007145923 6:39631322-39631344 TTGAAGAAAAATGGTGAGAATGG + Intronic
1007801098 6:44394059-44394081 TTGAAGAAACAGAAGATGAAGGG - Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008229426 6:48966146-48966168 TTTACGTAACAGGTGGAGAAGGG + Intergenic
1008633071 6:53382337-53382359 GGGAAGAAACAGGATGAAAATGG - Intergenic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1009972881 6:70643579-70643601 TTGAAGAAACAGGGGTAGATGGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010843465 6:80676613-80676635 ATGAAAAAACAGGGGGAAAAGGG + Intergenic
1010965629 6:82204136-82204158 TTAAAGAAACAGAAGTAGACAGG + Intronic
1011154387 6:84313809-84313831 GAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011248818 6:85348729-85348751 TTGAGGCAACTGGAGGAGAGTGG - Intergenic
1011433471 6:87313212-87313234 ATCAAGGAACAGGAGAAGAAAGG + Intronic
1012129502 6:95472674-95472696 TTGAAAAAACATTAGAAGAATGG + Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1013063890 6:106663922-106663944 GTGTAGAAAGAGGAAGAGAAGGG - Intronic
1013069549 6:106716209-106716231 TAGAGGAAACAGGAAGAGAATGG - Intergenic
1013438357 6:110136837-110136859 TTGAAGAACAAGTAGGAGTAGGG - Intronic
1014084932 6:117331366-117331388 TTGGAGTACCAGGAGGAGATGGG + Intronic
1014236257 6:118958781-118958803 TTAAAAGGACAGGAGGAGAAGGG - Intergenic
1014344795 6:120254608-120254630 ATGAACAAAGAGGAGGAGATGGG + Intergenic
1014751337 6:125260163-125260185 TGGAAGAAAAAAGAGGAGAGAGG + Intronic
1015011616 6:128356180-128356202 CTAAAGAAACAGGAGAAGAGGGG - Intronic
1015212845 6:130717586-130717608 GTGAAGACAGAGGAGGAGATTGG + Intergenic
1015405265 6:132829352-132829374 TTAAAGAAAAGGGAAGAGAAGGG + Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015878083 6:137844451-137844473 TTGAAGAAAGAGGAGGAGTGTGG + Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016946992 6:149544730-149544752 TAGAAGAAACAGCAAAAGAATGG + Intronic
1017112896 6:150949347-150949369 TAGAAGACACAGGAGTAGATGGG - Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017577762 6:155824138-155824160 TTAAAGAAATAAGAGTAGAAAGG - Intergenic
1017619472 6:156281021-156281043 TTGAAGAAACAGGAAATGAATGG - Intergenic
1018151359 6:160942830-160942852 ATGAAGAAATAGCAAGAGAATGG - Intergenic
1018393158 6:163356193-163356215 CTGAAGGAATAAGAGGAGAAAGG - Intergenic
1018512575 6:164541076-164541098 GTGAAGACACAGGTGGAGATTGG - Intergenic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1019827540 7:3297111-3297133 CATAAGAAAAAGGAGGAGAAAGG + Intergenic
1020401673 7:7785564-7785586 GTTAAGAAAGAGTAGGAGAATGG + Intronic
1021139440 7:17005847-17005869 TCCAAGAAGGAGGAGGAGAAGGG - Intergenic
1021332351 7:19354505-19354527 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1021613442 7:22479248-22479270 TGGAAGAAACAAAAGGAGATAGG + Intronic
1021857424 7:24871054-24871076 ATGAAGAAACTGGAGTACAAAGG + Intronic
1022260869 7:28703698-28703720 TAGAAGAAAAAGGTGGAGGAAGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022544243 7:31170664-31170686 TTGAAGAAATAGGAGAACATTGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1023048513 7:36231700-36231722 TTGCAGAATCAGCAGAAGAAAGG + Intronic
1023289813 7:38657256-38657278 ATGAGGAAACAAGAGCAGAAAGG - Intergenic
1023443289 7:40206325-40206347 TTGAAGAAACATGCAAAGAATGG - Intronic
1023507943 7:40919853-40919875 GTGAAGAATCAGGAGGAGTCAGG - Intergenic
1023540945 7:41265198-41265220 TGGAAGGAACATGAGTAGAAGGG - Intergenic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024070962 7:45785028-45785050 GGGAAGAAAAGGGAGGAGAAGGG - Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1025582810 7:62741672-62741694 TTGAAAAAACATTAGAAGAATGG - Intergenic
1026405501 7:70061469-70061491 TTTAAGAGAGAGGAAGAGAATGG + Intronic
1026638766 7:72106497-72106519 TGGAAGGGAGAGGAGGAGAAGGG + Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1027885176 7:83895015-83895037 TTGAAGAAACAGTAGTATAAAGG + Intergenic
1028312979 7:89361923-89361945 GTGAAAAAAAAGGAGGTGAATGG - Intergenic
1028367989 7:90057045-90057067 TTGAAGGACCAGAAGAAGAAAGG + Intergenic
1028443913 7:90896319-90896341 TTGAAGAGAGAGAATGAGAAAGG - Intronic
1028556239 7:92128345-92128367 CTGAAGAATCATGAGAAGAAAGG - Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1028668617 7:93375400-93375422 TTGATATAACAGGAAGAGAATGG + Intergenic
1028960343 7:96741792-96741814 TTCAAGGATCAGGAAGAGAAAGG + Intergenic
1029912565 7:104170107-104170129 TTCAAGAAACTCAAGGAGAAAGG - Intronic
1029967430 7:104754766-104754788 ATTAAGGAACAGGAGGAGCATGG + Intronic
1030447534 7:109666404-109666426 TTAAAGAAAAAGGAGGACAGAGG - Intergenic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030638251 7:111974556-111974578 TTGCAGAGAGAGGAGGAGGAAGG + Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1031129321 7:117813231-117813253 TTGAAGAAACTGTAGATGAAGGG - Intronic
1031293129 7:119965120-119965142 TTAGAGAAAGAGGAGGAGAGGGG + Intergenic
1031352435 7:120751543-120751565 TTGAAGATAAAGGAGAAAAAAGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033149122 7:138897973-138897995 TTGAAGAAAAAGGAGGCACATGG - Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1033942893 7:146677798-146677820 TTCCAGAAACAAGAGGATAAGGG + Intronic
1034008634 7:147503898-147503920 TTAAAGAACCCTGAGGAGAAGGG + Intronic
1034822970 7:154234173-154234195 TAGAGGAAACAGCAGGAAAAAGG + Intronic
1034871155 7:154685172-154685194 TTTATGAGACAGGAGGGGAAAGG - Intronic
1035942237 8:3914305-3914327 TTTAAGAACGAGGAAGAGAATGG + Intronic
1036100728 8:5781098-5781120 TTGAAGAAATCGAAAGAGAATGG - Intergenic
1036100913 8:5783686-5783708 TGGAAGACACAAGAGGAGCAAGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036467836 8:9018192-9018214 GGGAAGAAACAGTATGAGAAAGG - Intronic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036939281 8:13035827-13035849 TTGAAAAGACAGGAGTAAAAGGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037395782 8:18441276-18441298 TTGAAAATAAGGGAGGAGAAAGG - Intergenic
1037660057 8:20918741-20918763 GTGAAGACACAGGATGAGATGGG + Intergenic
1037895566 8:22651456-22651478 ATGAAGAAAGAGGAGGATCAGGG - Intronic
1038006039 8:23431202-23431224 TTGGAGAAACAGGAGAGAAAAGG - Exonic
1038415101 8:27389396-27389418 TTGAAGAACTAAGAGAAGAATGG + Intronic
1038483665 8:27918890-27918912 GGGAAGAAAGAGGAGGAGGAAGG + Intronic
1038526992 8:28283291-28283313 GTGAGGAAACAGCAGAAGAATGG + Intergenic
1039380203 8:37077793-37077815 TGGAAGAAACATGAGGGGAGAGG - Intergenic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040965698 8:53078756-53078778 TTAAAGAAAAAGGAAGACAAAGG - Intergenic
1041524774 8:58792936-58792958 TGGAAGAAACAGAAAAAGAAGGG + Intergenic
1041573568 8:59366826-59366848 TTGAAAAAAAAGGAGGAAAATGG - Intergenic
1041972946 8:63763970-63763992 TTCCAGAAACTGGAAGAGAATGG - Intergenic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1043060056 8:75488760-75488782 TTGAGGAAATAGAATGAGAAAGG - Intronic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1044394620 8:91696187-91696209 TGGAAGAAGAAGTAGGAGAAGGG - Intergenic
1044476162 8:92628836-92628858 CTGAAGTCACAAGAGGAGAAAGG - Intergenic
1045239134 8:100383422-100383444 TTCAAGGAAGAGGAGAAGAAGGG + Intronic
1045256432 8:100527902-100527924 TTGGAAGAACAGGAGGTGAAAGG - Exonic
1045281001 8:100749702-100749724 ATGGAGGAAGAGGAGGAGAACGG + Intergenic
1045300970 8:100909562-100909584 ATGAACAGACAGGAGGAGACCGG + Intergenic
1046479948 8:114802488-114802510 GAGAAGAAATAGGAGCAGAATGG + Intergenic
1046490065 8:114939981-114940003 TTTAAAAAAAAGGAGAAGAAAGG + Intergenic
1046504418 8:115118580-115118602 TTGAATGAACAGTATGAGAAAGG + Intergenic
1046537333 8:115532019-115532041 CTGAAGAAAAAGGAGTCGAAGGG + Intronic
1046552752 8:115737451-115737473 TTGAAGAAAATCTAGGAGAATGG - Intronic
1046748675 8:117903641-117903663 CTGAAGAAAAAGGAGGAAAATGG - Intronic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047713097 8:127571189-127571211 ATGAAGAAAGAGGAGGAGATGGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047884568 8:129234905-129234927 TTGTAGAAACACCATGAGAAAGG + Intergenic
1047956569 8:129981137-129981159 TTGAAAAAAAAGGTGGGGAATGG - Intronic
1048072590 8:131038577-131038599 TAGAAAAAAAAGGAGGAGAAAGG + Intronic
1048247721 8:132827044-132827066 TTGAAGATACAGGATCAAAATGG + Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048696276 8:137031665-137031687 GGGAAGAATTAGGAGGAGAAGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1049030089 8:140028794-140028816 ATGAGAATACAGGAGGAGAAAGG + Intronic
1049674019 8:143881826-143881848 TAGAAGACAGAGGAGGAGGAGGG + Intergenic
1049924159 9:392788-392810 CTCAAGAAACAAGAGGGGAATGG - Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050324124 9:4483792-4483814 TGTCAGTAACAGGAGGAGAAAGG - Intergenic
1050642828 9:7686561-7686583 TTGAGGAAAGAGGAGAAGAAAGG + Intergenic
1050744685 9:8861560-8861582 GTGAGGAAACAGGACGAGAGAGG + Intronic
1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG + Intergenic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051474153 9:17484737-17484759 TTAAAGAAAATGGAGGAGATAGG - Intronic
1051761290 9:20467758-20467780 ACGAAGAAAGAGGAGGAAAAAGG + Intronic
1052129474 9:24824838-24824860 TTCAAGTAACAGCAAGAGAAAGG - Intergenic
1052546804 9:29890138-29890160 TTGAAGTACCAGAAGGAGACTGG + Intergenic
1053393996 9:37755751-37755773 TTGGAGAAACATGAGGTAAAAGG + Intronic
1053444297 9:38139940-38139962 TGCAAAGAACAGGAGGAGAAGGG - Intergenic
1053527469 9:38844638-38844660 TAGAACAAAAAGGCGGAGAAAGG + Intergenic
1053647289 9:40130960-40130982 TGGCAGATACAGGAGGAGGATGG - Intergenic
1053758437 9:41332883-41332905 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054199693 9:62069067-62069089 TAGAACAAAAAGGCGGAGAAAGG + Intergenic
1054328289 9:63728916-63728938 TGGCAGATACAGGAGGAGGATGG - Intergenic
1054537290 9:66245210-66245232 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054638662 9:67519290-67519312 TAGAACAAAAAGGCGGAGAAAGG - Intergenic
1054712648 9:68526594-68526616 TTGAAGAAAGAGGATCACAATGG - Intronic
1055001509 9:71455286-71455308 TTGAAAAAACAGGAGTTTAAAGG - Intergenic
1055431483 9:76248410-76248432 GTGAAGAAAAAGGAAGAGAGAGG + Intronic
1055644962 9:78354790-78354812 TTGCACAAACAGGAAGGGAATGG + Intergenic
1055664771 9:78542382-78542404 TTGAAAAAAGAGGAAGAGAGTGG + Intergenic
1055784474 9:79857771-79857793 AAAAAGAAAAAGGAGGAGAAAGG + Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056693599 9:88828019-88828041 TTACAGAAACAGGAGGAAAGAGG + Intergenic
1056819662 9:89829855-89829877 TGGAAGGCAAAGGAGGAGAAAGG + Intergenic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1057718187 9:97512046-97512068 TTGAAGGACCAGGAGGAACATGG - Intronic
1058463420 9:105204755-105204777 ATGCAGGAACAGGAGCAGAAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058861034 9:109118221-109118243 TTGAGGGAACAAGAGAAGAAGGG + Intronic
1058901542 9:109446629-109446651 CTGGAGAAAGAGGAGGTGAATGG + Intronic
1059284888 9:113163769-113163791 TAGAAGAAAGATGAGGATAAAGG - Exonic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059788450 9:117612962-117612984 GAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060451826 9:123750022-123750044 GAAAAGAATCAGGAGGAGAAAGG + Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061576690 9:131511802-131511824 TTGCAGAAACTTTAGGAGAAAGG + Intronic
1062157125 9:135057673-135057695 TTTCAGAAAGAAGAGGAGAAGGG + Intergenic
1062307825 9:135919675-135919697 TTGCAGAACCTGGGGGAGAAGGG - Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062741887 9:138179778-138179800 TGGAGGGAAGAGGAGGAGAAGGG + Intergenic
1202795078 9_KI270719v1_random:114257-114279 TGGCAGATACAGGAGGAGGATGG - Intergenic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203719403 Un_GL000216v2:2326-2348 TTGAAGCAACATGAGTGGAATGG - Intergenic
1203719918 Un_GL000216v2:5941-5963 TTGAAGCAACATGAGTGGAATGG - Intergenic
1186011184 X:5134923-5134945 GTGAAGGAAAAGAAGGAGAATGG + Intergenic
1186121192 X:6362941-6362963 TTGAATAACCTGGAGCAGAAAGG + Intergenic
1186529330 X:10279503-10279525 TTGAACAAAAAGGTGGAGAAAGG - Intergenic
1186940994 X:14507219-14507241 TTTAAGAATCAGGAGCAGCAAGG - Intergenic
1187295710 X:17998782-17998804 CTAAAGAAACAGGAGGTGAGAGG + Intergenic
1187477018 X:19620283-19620305 GGGAAGGAACAGGAGGTGAAGGG + Intronic
1188591783 X:31845624-31845646 TTGAACAAACAGGAGCAGCACGG + Intronic
1188604585 X:32012462-32012484 TTGAAGAAACAGTAGCAGCCGGG - Intronic
1188922667 X:35996955-35996977 TTTAAAAAACAACAGGAGAATGG - Intergenic
1189135663 X:38546876-38546898 TAGAGGAAAGAGGAGGAAAAGGG + Intronic
1189215101 X:39316301-39316323 TGGAAGAGAGAAGAGGAGAAGGG + Intergenic
1189423574 X:40878867-40878889 TTGAATAAAAGGGAGGAAAAAGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189853401 X:45199339-45199361 TTGAGGAAGATGGAGGAGAAAGG + Intronic
1190086250 X:47397771-47397793 CTGAAGCAACAGGAAAAGAAGGG - Intronic
1190114585 X:47618412-47618434 TTGAAGAAGTAGCTGGAGAACGG + Intronic
1190595197 X:52045847-52045869 ATGAAGAAACTGGAGAAAAAAGG + Intergenic
1190602699 X:52108721-52108743 TTGAAGAGACGAGAGGAGAGTGG - Intergenic
1190613627 X:52208226-52208248 ATGAAGAAACTGGAGAAAAAAGG - Intergenic
1191604675 X:63047982-63048004 TCAAATAAACAGGTGGAGAAAGG - Intergenic
1191691687 X:63945790-63945812 TGGGAGAAACAAGAGGTGAAGGG + Intergenic
1191696279 X:63994071-63994093 TTGAGGAAGCAGGAGGAAAAGGG + Intergenic
1191958595 X:66673969-66673991 TACAAGAAAAAGGAGAAGAAAGG + Intergenic
1192023090 X:67416434-67416456 TGGCAAAAACAGGAGGAAAAGGG - Intergenic
1192309939 X:70002703-70002725 TTGAGGAAACAGGACAAGAGAGG - Intronic
1192341109 X:70264163-70264185 TGGAACAAACTGGAGGAGTAGGG - Intergenic
1192618261 X:72650570-72650592 TTCAAGAGACAGGTGTAGAAAGG + Intronic
1193048230 X:77075728-77075750 TTGGAGTAACAGAAGGAGATGGG - Intergenic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1194410459 X:93551396-93551418 GTAAAGAAAAAGGAGGAAAAGGG - Intergenic
1194864543 X:99049539-99049561 TTGAAGCATGAGCAGGAGAAAGG + Intergenic
1194912301 X:99661363-99661385 TTGAAGTAGCAGGTGAAGAAGGG - Intergenic
1195163782 X:102197505-102197527 GTGAAGGAAAAGGAAGAGAAAGG - Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195460469 X:105117702-105117724 TGGAAGAAAAAGGGGAAGAAAGG - Intronic
1195656093 X:107332829-107332851 TGAAAGAAGAAGGAGGAGAAAGG - Intergenic
1196038837 X:111178397-111178419 TTGAAGAAAAAGAAAGAGACAGG + Intronic
1196163559 X:112513316-112513338 GTGATGTAACAGGAGGAAAATGG + Intergenic
1196529602 X:116770094-116770116 GTGAAGATACAGGCGGAGATTGG - Intergenic
1197017530 X:121644878-121644900 TTCAGGAAACAGGAAGAGAAAGG + Intergenic
1197027021 X:121764556-121764578 TTGAAGAAAGAGGAGAAAACTGG + Intergenic
1197478115 X:126948035-126948057 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1197821816 X:130548924-130548946 TGGAAGCAACAGAAGGAGTAAGG + Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198161882 X:134016176-134016198 CTGATGAAAAAGGGGGAGAAAGG + Intergenic
1198615078 X:138448467-138448489 TTGATGAAAAAGGAGAAGAGAGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199330554 X:146553227-146553249 TTTCAGAAAGTGGAGGAGAAGGG - Intergenic
1199515535 X:148670879-148670901 ATGAAAAAAATGGAGGAGAAAGG - Intronic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199916199 X:152343553-152343575 TTAGAAAAAGAGGAGGAGAAAGG - Intronic
1199948761 X:152688691-152688713 GTGAAGACACAGGAAGAGAATGG + Intergenic
1199960915 X:152779758-152779780 GTGAAGACACAGGAAGAGAATGG - Intergenic
1199988312 X:152968511-152968533 TGAAAGAAGCAGGAGGAGCAGGG + Intronic
1201113985 Y:10821686-10821708 TTAAAGAGACTGGAGTAGAATGG - Intergenic
1201174316 Y:11298680-11298702 TTGAATGAACGGGAGGGGAATGG - Intergenic
1201203671 Y:11563303-11563325 TGGAAGAGAAAGGAAGAGAATGG + Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic