ID: 1036645849

View in Genome Browser
Species Human (GRCh38)
Location 8:10611214-10611236
Sequence GGCTGTGGTCCGCGAATGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036645849_1036645854 -7 Left 1036645849 8:10611214-10611236 CCAGCCATTCGCGGACCACAGCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1036645854 8:10611230-10611252 CACAGCCTCTGGAGACGAGCGGG 0: 1
1: 0
2: 4
3: 12
4: 216
1036645849_1036645857 5 Left 1036645849 8:10611214-10611236 CCAGCCATTCGCGGACCACAGCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1036645857 8:10611242-10611264 AGACGAGCGGGGCAGAGAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 226
1036645849_1036645855 -6 Left 1036645849 8:10611214-10611236 CCAGCCATTCGCGGACCACAGCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1036645855 8:10611231-10611253 ACAGCCTCTGGAGACGAGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 83
1036645849_1036645853 -8 Left 1036645849 8:10611214-10611236 CCAGCCATTCGCGGACCACAGCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1036645853 8:10611229-10611251 CCACAGCCTCTGGAGACGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 325
1036645849_1036645859 20 Left 1036645849 8:10611214-10611236 CCAGCCATTCGCGGACCACAGCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1036645859 8:10611257-10611279 AGAGCTGGGTGACACACCACTGG 0: 1
1: 0
2: 0
3: 14
4: 133
1036645849_1036645858 6 Left 1036645849 8:10611214-10611236 CCAGCCATTCGCGGACCACAGCC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1036645858 8:10611243-10611265 GACGAGCGGGGCAGAGAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036645849 Original CRISPR GGCTGTGGTCCGCGAATGGC TGG (reversed) Exonic
902430510 1:16359483-16359505 GGCTGAGGTAGGAGAATGGCCGG - Intronic
903516996 1:23917935-23917957 GGCTGTGGCAGGAGAATGGCAGG + Intergenic
903935114 1:26890089-26890111 GGCCGCGGGCCGCCAATGGCAGG - Exonic
905626151 1:39491673-39491695 GGCTGCGGTCCGCGCAGCGCAGG - Exonic
905846999 1:41241886-41241908 GTCTGTGGTCCGCGCGGGGCTGG - Intronic
906768140 1:48455481-48455503 GGCTGAGGTAGGAGAATGGCGGG - Intronic
908303339 1:62784323-62784345 GTCTCTGGTCCCCGAATGACTGG + Intronic
908768141 1:67572464-67572486 GGCTGTGGTCCGGGTAGGACAGG - Intergenic
920069389 1:203291287-203291309 GGGTGTGGCCCGGGAAAGGCAGG - Intergenic
920393883 1:205629939-205629961 GGCTGAGGTGGGAGAATGGCCGG + Intronic
920531553 1:206706278-206706300 GGCTGTGGCCAGGGAAAGGCAGG - Intronic
921939232 1:220823056-220823078 GGCTGTGGTCCCCTGAGGGCTGG - Intergenic
1063119743 10:3096975-3096997 GGCTGAGGTGGGAGAATGGCAGG + Intronic
1065999055 10:31087360-31087382 GGCAGTGGACCCCGAATGGAGGG - Intergenic
1072670624 10:97426460-97426482 GGGTGTGGGCTGCGAAGGGCCGG + Intronic
1076370603 10:129950298-129950320 GGCTGTGGTGCCCGAGTGGATGG - Intronic
1077464744 11:2728353-2728375 GGCTGTGGTCCCCTGAGGGCTGG - Intronic
1083990780 11:66244488-66244510 GGCTGTGGGGCGCAGATGGCCGG - Exonic
1089789800 11:120934425-120934447 GGCTGTGGTCTGCGTCTGCCTGG - Intronic
1090417026 11:126547706-126547728 GTCTGTGGTCAGTGAATGGTGGG + Intronic
1092357530 12:7809098-7809120 GGCTGTGGCAGGAGAATGGCAGG - Intergenic
1092605631 12:10115329-10115351 GGCTGAGGTAGGAGAATGGCGGG + Intergenic
1094553129 12:31471396-31471418 GGCTGAGGCCCGAGAATTGCAGG - Intronic
1100877688 12:98980299-98980321 GGCTGAGGTAGGAGAATGGCGGG - Intronic
1101448342 12:104754404-104754426 CACTGTGGTCCGTGGATGGCTGG + Intronic
1102581350 12:113890259-113890281 GGCTCTGGGCCGTGAGTGGCCGG + Intronic
1103229863 12:119320394-119320416 GGCTGAGGTAGGAGAATGGCTGG - Intergenic
1104690841 12:130825135-130825157 GGCTGTGGTGGGAGAATCGCTGG - Intronic
1105611416 13:21973093-21973115 GGCTGAGGCCGGAGAATGGCCGG - Intergenic
1109806546 13:67451871-67451893 GGCTGTGGCACGAGAATCGCTGG + Intergenic
1111197947 13:84898052-84898074 GGCTGAGGTGGGAGAATGGCGGG + Intergenic
1112959247 13:105102759-105102781 GGCTGAGGTCAGAGAATTGCTGG + Intergenic
1114330000 14:21627297-21627319 GGCTGAGGTAGGAGAATGGCGGG - Intergenic
1121730858 14:96186120-96186142 CCCTGTGGTCCCAGAATGGCAGG - Intergenic
1121750769 14:96353523-96353545 GGCTGAGGTACGAGAATCGCTGG + Intronic
1125565945 15:40678483-40678505 GGCTGAGGTAGGAGAATGGCGGG - Intergenic
1126099941 15:45112936-45112958 GGCCGTGGCTCGCGAAGGGCCGG - Intronic
1129883950 15:79025774-79025796 GGCTGAGGTCTGGGGATGGCAGG + Intronic
1131202216 15:90408890-90408912 GGCTGAGGTCTGGGGATGGCTGG - Intronic
1132127388 15:99240012-99240034 GACTGTGGTCAGTGAAAGGCAGG - Intronic
1132145420 15:99426350-99426372 GGCTGTGGCCCGTGGAGGGCAGG - Intergenic
1132503278 16:294058-294080 GGCTGGGGCCCGAGAATGGCTGG + Intronic
1133325821 16:4941693-4941715 GGCTGAGGTAGGAGAATGGCTGG - Intronic
1137039938 16:35601123-35601145 GGCTGAGGTGGGAGAATGGCTGG + Intergenic
1137754099 16:50887832-50887854 GGCTGGGGTCAGGGCATGGCTGG + Intergenic
1138517378 16:57543676-57543698 GGCTGTGTGCGGAGAATGGCTGG + Intronic
1141595787 16:85096015-85096037 GGCTGTGGTCCTGGAATTGGTGG - Intergenic
1142693070 17:1618592-1618614 GGCTGTGAGCCCCGAAGGGCAGG + Intronic
1146186985 17:30730643-30730665 TGCTGTGGTCCAGGAATAGCAGG + Intergenic
1149006460 17:51811093-51811115 GGCTGAGGTCGGAGAATCGCTGG + Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1153883366 18:9439722-9439744 GGCTGAGGCACGAGAATGGCTGG + Intergenic
1155145995 18:23084250-23084272 GGCTGAGGTGGGAGAATGGCAGG - Intergenic
1160459882 18:79030916-79030938 GGCTGTGGTCTGCCACTTGCTGG + Intergenic
1160898175 19:1412556-1412578 GGCTGCTGGCCCCGAATGGCCGG + Intronic
1162971912 19:14185846-14185868 TGCTGTGGTCCAGGAATAGCAGG - Intronic
1166610562 19:44190432-44190454 GGCTGAGGTAGGAGAATGGCAGG - Intergenic
1168407556 19:56118884-56118906 GGCTCTGGGCAGGGAATGGCAGG - Intronic
927917254 2:26945189-26945211 GGCTGGGGTGGGCGAAGGGCTGG - Intronic
928393110 2:30924338-30924360 GGCAGTGTTCTGAGAATGGCAGG + Intronic
930368009 2:50466965-50466987 AGCTGTTGTCAGTGAATGGCTGG - Intronic
931140509 2:59452802-59452824 GGCTGAGGTAGGAGAATGGCAGG - Intergenic
931309577 2:61065810-61065832 GGCGCTGGCCCGCGATTGGCCGG + Intergenic
935613116 2:105046679-105046701 GGCTGTGGTTGGTGATTGGCAGG + Intronic
938058559 2:128234487-128234509 GGCTGTGGTGGGAGAATTGCTGG + Intergenic
941183388 2:162288669-162288691 GGCTGTGGTGCGGGATTGGCAGG + Intronic
1169542476 20:6615014-6615036 GGCTGTGGTCACAGACTGGCTGG + Intergenic
1171186556 20:23127602-23127624 GGCTGTGGGCCACTAAGGGCTGG + Intergenic
1174075610 20:47933681-47933703 GGCTGTGGTCCAAGAGTGGCGGG + Intergenic
1176965636 21:15208763-15208785 GCCTGTGGTCCGTGCCTGGCTGG - Intergenic
1177701598 21:24646088-24646110 GGCTGAGGCCGGAGAATGGCGGG + Intergenic
1184068567 22:42134647-42134669 GGCAGTGGTCAGCTAATGACTGG + Intergenic
949474376 3:4429762-4429784 GGCTGTGGGCTGAGATTGGCTGG - Intronic
951544424 3:23810619-23810641 GTCTGTGGTGCCCGAGTGGCGGG + Intronic
955229588 3:57086844-57086866 GGCTGTGCTCAGCAAATGCCAGG - Intergenic
956310193 3:67870351-67870373 GGCTGTGGTGGGAGAATTGCTGG + Intergenic
956663883 3:71624222-71624244 GGCTGAGGTACGAGAATTGCTGG + Intergenic
961276215 3:125729169-125729191 GGCTGAGGCACGAGAATGGCTGG + Intergenic
962260841 3:133904024-133904046 GGCTGAGGTGGGCGAATGGCTGG - Intergenic
966799394 3:183748698-183748720 GGCTGAGGTGGGAGAATGGCTGG - Intronic
968427453 4:533275-533297 GGCTGTGCTCCCCCAGTGGCTGG + Intronic
968882634 4:3309333-3309355 AGCTGGGATCCGGGAATGGCAGG + Intronic
968882775 4:3309861-3309883 AGCTGGGATCCGGGAATGGCAGG + Intronic
969227993 4:5811675-5811697 GGCTGTGGTGTGTGAAGGGCTGG - Exonic
976751704 4:88456560-88456582 GGCTGAGGTGGGAGAATGGCGGG - Intergenic
994536868 5:101042289-101042311 GGCTGAGGTAGGAGAATGGCGGG + Intergenic
994631464 5:102293833-102293855 GGCTGAGGCACGAGAATGGCTGG - Intronic
1005524438 6:26631913-26631935 GGCTGAGGTGGGAGAATGGCTGG + Intergenic
1006788589 6:36684198-36684220 GACTGTGATGCGCTAATGGCGGG + Exonic
1006821746 6:36901769-36901791 GGCTGAGGCCGGAGAATGGCGGG - Intronic
1014258333 6:119186605-119186627 GGCTGTGGTCTGGGAAGTGCTGG - Intronic
1016017371 6:139200031-139200053 GGCTGTGCTCAGCTACTGGCTGG - Intergenic
1017105843 6:150886893-150886915 GGCTGAGGTAGGAGAATGGCTGG + Intronic
1019534368 7:1520952-1520974 GGCTGTGGACCGCAAATGTCCGG + Intergenic
1022950328 7:35332284-35332306 GGCTGGGGGCCGGGAAGGGCGGG + Intergenic
1030064477 7:105648792-105648814 GGCTGTGGACCCTGAATGACAGG + Intronic
1032235395 7:130117748-130117770 GGCTGAGGTGGGAGAATGGCTGG + Intronic
1034629238 7:152517568-152517590 GGCTGAGGTAGGAGAATGGCAGG + Intergenic
1035024913 7:155818963-155818985 GGCTGAGGTCCGCGCACCGCAGG + Intergenic
1035869042 8:3117169-3117191 GGCTGAGGTGGGAGAATGGCGGG - Intronic
1036645849 8:10611214-10611236 GGCTGTGGTCCGCGAATGGCTGG - Exonic
1040931934 8:52744560-52744582 GGCTGAGGTAGGAGAATGGCTGG - Intronic
1041416323 8:57612867-57612889 GGCTGAGGCCAGAGAATGGCGGG + Intergenic
1051240167 9:15046707-15046729 GGCTGAGGTCAGCGAATCACTGG + Intergenic
1061485869 9:130920181-130920203 GGCTGTGGGCTGGCAATGGCTGG + Intronic
1190247547 X:48700456-48700478 GGCTGTGGGCTGCGAGTGCCAGG + Exonic
1190249091 X:48708656-48708678 GGCTGGGGTCTGGGAATGGCAGG - Exonic
1190320385 X:49176377-49176399 GGCAGGGGTCGGAGAATGGCAGG + Intronic