ID: 1036651633

View in Genome Browser
Species Human (GRCh38)
Location 8:10647793-10647815
Sequence CTGTTTGTACATCTTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036651633_1036651635 9 Left 1036651633 8:10647793-10647815 CCATGAACAAGATGTACAAACAG 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1036651635 8:10647825-10647847 ACCCTGTTTTCAATTCTTCTGGG No data
1036651633_1036651634 8 Left 1036651633 8:10647793-10647815 CCATGAACAAGATGTACAAACAG 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1036651634 8:10647824-10647846 GACCCTGTTTTCAATTCTTCTGG No data
1036651633_1036651638 26 Left 1036651633 8:10647793-10647815 CCATGAACAAGATGTACAAACAG 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1036651638 8:10647842-10647864 TCTGGGCATATACCTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036651633 Original CRISPR CTGTTTGTACATCTTGTTCA TGG (reversed) Intronic
901142175 1:7042339-7042361 CTGTTTCTTCCTCTTGTTCCTGG + Intronic
902104266 1:14020458-14020480 CTTTTTGTTCATCCTGTACAAGG - Intergenic
906459122 1:46023816-46023838 CTGCTTGTTGATCTTCTTCATGG - Exonic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
907329405 1:53661417-53661439 CTTTTTGAAAATCTTGTTCCAGG - Intronic
908486309 1:64597273-64597295 CTGCTTGTAAATCCTGTTGAAGG + Intronic
909980530 1:82094968-82094990 CTGTTTCAAAATCTTATTCAAGG - Intergenic
909988616 1:82193576-82193598 GGTTTTGCACATCTTGTTCATGG + Intergenic
910399217 1:86821720-86821742 CTGTTTGTCCATTATTTTCAGGG - Intergenic
910711072 1:90181518-90181540 CTGTTTGAAAATCTTTTTCCAGG - Intergenic
912820822 1:112866327-112866349 CTGTTTGTTCAGATTGTTCTTGG - Intergenic
916305688 1:163328824-163328846 CTTTTTGTACTTCATCTTCAAGG + Exonic
917590535 1:176471515-176471537 CTGTTTGTTTATCTGGTTGATGG - Intronic
917613388 1:176712954-176712976 CTATTTGTACATATTTTTTAAGG + Intronic
918047558 1:180950712-180950734 CTGTTTGCATATTTTGTTTAAGG + Exonic
918671494 1:187223281-187223303 CTGTTTGTACTTGTTCTTCTTGG + Intergenic
918739916 1:188116266-188116288 ATGTTTGAACATTTTGATCATGG - Intergenic
920111911 1:203592773-203592795 ATGTTTATACATCATGTTCCTGG + Intergenic
922616770 1:226965385-226965407 CTGTTTGTGCTGCTTGTTCTCGG - Exonic
923388202 1:233486796-233486818 CTCCTTGTTCAGCTTGTTCAGGG + Intergenic
1063812236 10:9724272-9724294 CTCATAGTAAATCTTGTTCAAGG + Intergenic
1066129209 10:32374335-32374357 CATTTTGCACATTTTGTTCACGG - Intronic
1067933643 10:50589036-50589058 CTATTTGTGAATCTTGATCAGGG + Intronic
1067987726 10:51169480-51169502 CTGTTTTTACTTCTTTTTCTTGG + Intronic
1068041456 10:51830409-51830431 CTGTTTGGAAATTTTGTTCCAGG + Intronic
1068094079 10:52468745-52468767 ATATTTTTACATCATGTTCATGG + Intergenic
1068411900 10:56666959-56666981 CTATTTGTATATCTTCTTCAGGG - Intergenic
1068928063 10:62560241-62560263 ATGTTTGTACATGATTTTCAGGG + Intronic
1069344985 10:67458199-67458221 CTGTGTGAACATCTTCTTCTTGG + Intronic
1074739621 10:116472907-116472929 TTGTTTCTACCTCTTCTTCATGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1081483675 11:43511076-43511098 CTATTTGTACACCATGTACATGG + Intergenic
1083192116 11:61059704-61059726 CTGTTTGTACATCTGCTAAAAGG + Intergenic
1084968144 11:72755119-72755141 CGCCTTGTACATCTTCTTCATGG + Exonic
1085928494 11:81052747-81052769 ATGTTTGTAAATCATGTTGAAGG - Intergenic
1086133727 11:83425843-83425865 CTGTTTGTTCATATTATTCTTGG - Intergenic
1086371386 11:86158760-86158782 CTGTTTGTATCTCAGGTTCATGG - Intergenic
1087871039 11:103293518-103293540 CTTTCTTTACATCTTCTTCAAGG + Intronic
1090276729 11:125425417-125425439 CTGTATCTACTTCTTTTTCAAGG + Intronic
1090577313 11:128119793-128119815 CCATTTGTATATCTTGTTCAGGG + Intergenic
1091781971 12:3219582-3219604 TTGTTTGTACATCTTTCTCTGGG + Intronic
1092647845 12:10597947-10597969 CTATCTGTACTTCTTGTTCTTGG - Intergenic
1092682444 12:10999818-10999840 CTGTGTGTTCTTCTTGTTCATGG + Intronic
1093175951 12:15913642-15913664 GTGTATGTACTTCTAGTTCATGG + Intronic
1093932643 12:24969648-24969670 CTTTTTCTACAGCATGTTCAAGG - Intergenic
1094403303 12:30086052-30086074 CAGTTTGTAGTTTTTGTTCAGGG - Intergenic
1096100458 12:48967921-48967943 ATGTGTGTACATCTTGTCCTGGG - Intronic
1098930733 12:76409309-76409331 CTGTTTGTTCAGCTTCTTCTTGG - Intronic
1099299947 12:80880057-80880079 ATGTTTGTAGATCTTCTCCATGG + Intronic
1099807448 12:87537308-87537330 CTGTATGTACTTTTTTTTCAGGG + Intergenic
1100071999 12:90733070-90733092 CTGTTTGTACATTTTGCTTTAGG + Intergenic
1102538965 12:113604471-113604493 CTTCTTGTTCATCTTGTTCTTGG + Intergenic
1103682177 12:122702858-122702880 CCGATTGGAGATCTTGTTCAGGG + Exonic
1103847035 12:123908815-123908837 CTGTTTGTCCATCTAGTAAATGG + Intronic
1104328812 12:127825309-127825331 CTATTGGTCCATCTTGTTCGTGG - Intergenic
1106160975 13:27201223-27201245 CTGTTTGTTCAGATTCTTCAAGG + Intergenic
1107408111 13:40134132-40134154 CTGTTTGTACAGCTTGCCCCTGG + Intergenic
1108401911 13:50053787-50053809 ATATTTGTACACCATGTTCATGG - Intergenic
1108759837 13:53549648-53549670 TTGTTTGTCCTTTTTGTTCACGG - Intergenic
1109138681 13:58684914-58684936 GTGTTTGAATATGTTGTTCAGGG + Intergenic
1109910072 13:68898019-68898041 TCTTTTGTACATTTTGTTCAGGG + Intergenic
1110582762 13:77151138-77151160 TTGTTTTTACACCGTGTTCATGG - Intronic
1111856444 13:93643566-93643588 CTGTTTGTACAGATTTTTCTGGG + Intronic
1111921141 13:94412394-94412416 CTGTTTGTACCTCATGAACAAGG + Intergenic
1115619193 14:35124010-35124032 CTGTGTTTACATCTTGATGAAGG - Exonic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1116935509 14:50735578-50735600 TTGTTTCTAATTCTTGTTCAAGG + Exonic
1118013877 14:61638841-61638863 CAGTTCAAACATCTTGTTCAAGG - Intronic
1118504995 14:66401572-66401594 CTCTTTGTTCATCTTCTTCTGGG + Intergenic
1124063325 15:26316562-26316584 CTCTTTGGACCTCTTATTCAAGG + Intergenic
1124723142 15:32130662-32130684 CTCTTTGTACACCTATTTCATGG + Intronic
1126452623 15:48826126-48826148 ATATTTGTACTTCTTTTTCAAGG - Exonic
1127500125 15:59547283-59547305 TTGTTTGTACATGTCTTTCAGGG + Intergenic
1128781685 15:70362633-70362655 CTGTATGGACATCCTGTTCCGGG - Intergenic
1131044860 15:89306128-89306150 CTGTGTGGACACCTTGTTAAAGG + Exonic
1134348586 16:13414931-13414953 CTGTCTATAAATCTTGTTCCTGG - Intergenic
1138115116 16:54354635-54354657 CTGTTTGTTCACCTTGGTTAGGG - Intergenic
1138569171 16:57857290-57857312 CTGTTTCCAAATCTTGTTCCAGG + Intronic
1138689755 16:58756314-58756336 CAGCTTGGACATCTTGTGCAGGG + Intergenic
1141364810 16:83432788-83432810 CTGTTTGCACTTCCTGATCAGGG - Intronic
1141454510 16:84131285-84131307 CAGTTTCTACCTCTTGTACAGGG - Exonic
1142474767 17:182201-182223 ATGTTTGTGCATCTTGTTAGGGG - Intergenic
1142977045 17:3651448-3651470 CTGTTTGTGCTTCAGGTTCAAGG - Intronic
1146059092 17:29595178-29595200 CTGTTTGTTCATCTGTTTCCTGG - Intronic
1146630182 17:34463981-34464003 TTGTTTAAACATCTTGATCAAGG + Intergenic
1148334956 17:46834831-46834853 CTGTTTCTCTAGCTTGTTCAGGG + Intronic
1149849147 17:60025207-60025229 ATGTTTGTGCATCTTGTTAGGGG + Intergenic
1149861021 17:60121317-60121339 ATGTTTGTGCATCTTGTTAGGGG - Intergenic
1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG + Intergenic
1152557543 17:81061304-81061326 CTGTTTGTACAACTTCATCGAGG + Intronic
1153288785 18:3480449-3480471 CTCTTTGTACATCCTCTTCCAGG + Intergenic
1153667863 18:7382360-7382382 CTGTTTGTAGATTTAGTTTATGG - Intergenic
1154494919 18:14948508-14948530 CTCTTTGTACCTCTTCTTGATGG - Intergenic
1155974425 18:32112947-32112969 CTGCTTTTACATCTTTTTGAAGG + Intronic
1158099471 18:53813318-53813340 CTATTTGTACTTCTTATTGAAGG - Intergenic
1159634189 18:70785327-70785349 CTATTTCTACATGTTGTCCAGGG + Intergenic
1162130200 19:8521665-8521687 TGGTCTGTCCATCTTGTTCATGG + Intronic
1162170870 19:8787834-8787856 CTGTATGAATATCTTGTTCTGGG + Intergenic
1162755753 19:12858575-12858597 CTGCTTGTTGATCTTTTTCATGG - Exonic
1163579605 19:18130538-18130560 CTGTTTGTTGATCTTCTTGATGG - Exonic
1164361052 19:27510929-27510951 CTTTTTGTACATCTTGAGAAGGG + Intergenic
1164403014 19:27915337-27915359 ATATTTGTGCATCTTGTTCCCGG + Intergenic
926310876 2:11675271-11675293 CTGTTTGTAAATCTCATTCGTGG + Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
930607396 2:53506676-53506698 CTGCCTGTACATATTGTCCATGG + Intergenic
930660022 2:54044104-54044126 CTGTGTGTACATCTGTTGCAGGG - Intronic
932503572 2:72206467-72206489 CCATTTGTACCTATTGTTCATGG + Intronic
933765853 2:85708786-85708808 ATGCTGGTACATCTTGTTCCTGG - Intergenic
934570808 2:95372239-95372261 CTGTGTGTACATCTGCTCCACGG + Intronic
935574339 2:104693331-104693353 CTATTTGTACACCATGTTCATGG - Intergenic
936733498 2:115411441-115411463 CTGTATTTGCATCTTGGTCAAGG + Intronic
937999540 2:127720870-127720892 ATTTTTGTCCATCTTGATCAGGG + Intronic
938432685 2:131259648-131259670 CCGTTTGTACATCTTCTTTTGGG + Intronic
939042913 2:137213704-137213726 CTGTTTTCAAATCTTGCTCATGG + Intronic
941448409 2:165629435-165629457 CAGTTTGTGCATCTCATTCACGG + Intronic
942707029 2:178785810-178785832 CTGATTTTTCACCTTGTTCATGG - Intronic
943388249 2:187228865-187228887 ATGTTTGTATATCTTACTCAAGG + Intergenic
1169446960 20:5680199-5680221 CTGTTTGTCCTTCTTTTCCAGGG - Intergenic
1170069898 20:12355165-12355187 CAGTATGTATTTCTTGTTCATGG + Intergenic
1171131166 20:22653916-22653938 AGGGCTGTACATCTTGTTCACGG + Intergenic
1175001674 20:55635875-55635897 CTGTTTTCACATTTTGTACATGG - Intergenic
1175781771 20:61687297-61687319 CTGTTGGGATAACTTGTTCAGGG + Intronic
1176223530 20:63981244-63981266 CGGTTTCTTCTTCTTGTTCATGG - Exonic
1177384749 21:20393982-20394004 CTGTTTGTTCAACTTTTTCAGGG + Intergenic
1178230201 21:30774615-30774637 CTGTTTGTACATCCTTTTTGAGG - Intergenic
1183842864 22:40514802-40514824 CGGTTTGTACATGCTCTTCAGGG + Intronic
949298705 3:2558008-2558030 CTGTATGTACATATCTTTCAAGG + Intronic
952540138 3:34358697-34358719 TTGTTTGTACATCTTATATATGG + Intergenic
952562166 3:34607544-34607566 CTGTTTGTATATCTTCTTTTGGG + Intergenic
953270495 3:41438304-41438326 CACTTAGTACATCTTATTCATGG + Intronic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
957559647 3:81805979-81806001 CTGTTTCTAAAACTTGTCCAAGG - Intergenic
957900204 3:86480171-86480193 TTGTTTGTACCTATTGTTCTTGG + Intergenic
959563773 3:107813560-107813582 TTGCTTGTACATATTTTTCAGGG - Intergenic
959823390 3:110764311-110764333 CTGTTTGTATATCTTCTTTTGGG - Intergenic
962262987 3:133926864-133926886 CTGTTTGCACTTCTCCTTCATGG + Intergenic
964177898 3:153847642-153847664 CTGTTTCTCCATCATGTTCATGG + Intergenic
966614151 3:181896286-181896308 ATGTTTATACTACTTGTTCAAGG + Intergenic
967312568 3:188119961-188119983 CTGTTTGTACCTCTGGGACATGG - Intergenic
967670990 3:192235152-192235174 CTGTGAGTCCATCTGGTTCAGGG + Intronic
968328350 3:197841641-197841663 CTGTTTTTACTTCTTTTTGAAGG + Intronic
969223298 4:5775754-5775776 CTGTGTGTACATATTTTTCTTGG + Intronic
974174543 4:58307173-58307195 ATGTCTCTAGATCTTGTTCAGGG - Intergenic
975127148 4:70795581-70795603 CTGTGTGTACATATTATACAAGG + Intronic
975410917 4:74048569-74048591 CTGTTTATCCATCTGGTTCTGGG + Intergenic
976187465 4:82456903-82456925 CTCTTTGTTCAGCTTGTTGATGG + Exonic
977136374 4:93309937-93309959 TTGTTTATACATATTGTGCAGGG + Intronic
979341393 4:119528614-119528636 GAGATTGAACATCTTGTTCAGGG - Intronic
981581357 4:146251555-146251577 CTTTTTGTCAATCTTTTTCATGG + Intergenic
982743723 4:159084756-159084778 CTGGTTGCACACCTTGTTCCTGG + Intergenic
986500769 5:8397021-8397043 CTGTTTCTTCATGTGGTTCATGG + Intergenic
988402002 5:30775138-30775160 CTGTTTGGCCATCTTGCCCAGGG - Intergenic
990875286 5:60477408-60477430 CTGTTTTTAAAGCTTGGTCAGGG - Intronic
991190801 5:63871010-63871032 CTCTGTGTGCATCTTCTTCATGG - Intergenic
991485406 5:67130254-67130276 CTGTTTATTAATCTTCTTCATGG - Exonic
992764942 5:79990027-79990049 CTATTTTTACATCTTGTCCCAGG + Intronic
993073587 5:83197959-83197981 CTGTAAATACATCTTGATCATGG + Intronic
993962409 5:94315871-94315893 CTCTTTGTATCTGTTGTTCACGG + Intronic
994620976 5:102162315-102162337 CTGTTTGTAAAACTTTTTCTAGG - Intergenic
996645626 5:125812627-125812649 TTAATTGTACATCTTGTTCCAGG - Intergenic
996968415 5:129332414-129332436 CTGTTTGTACCCATTCTTCATGG - Intergenic
999678410 5:154031003-154031025 CTTTTTGTAAAGCTTGTTTAGGG - Intronic
999699546 5:154215770-154215792 GTGTTTGAACTACTTGTTCAAGG + Intronic
1002424795 5:179168552-179168574 CTGTTTGTAGAGCTTCTTCTGGG - Intronic
1003073010 6:2959342-2959364 CTGATTTTAAATCTTGTTCCAGG - Exonic
1003833987 6:10047748-10047770 CTGTTTCTACAAGTTCTTCATGG + Intronic
1004299554 6:14444824-14444846 CTGTTTGTCCATATTCTTCGTGG + Intergenic
1005187394 6:23178263-23178285 CTGGTTTTACATCTTGTTATTGG + Intergenic
1005841401 6:29746858-29746880 CCATTTGTACATCTTGTTTGGGG - Intergenic
1005880073 6:30050353-30050375 CTATTTGTATATCTTCTTTAGGG - Intergenic
1005944559 6:30585882-30585904 CTGCTGGTACATCTTTTTGAAGG - Exonic
1006023993 6:31135658-31135680 CTGTTTCTAACACTTGTTCAAGG - Intronic
1008292088 6:49728364-49728386 CTTTTTGTACATTTTGTTCTAGG + Exonic
1008304439 6:49884803-49884825 CTCTTTGTACCTCTTCTTTAAGG + Intergenic
1010102713 6:72128238-72128260 ATGTATGTACATCTTTTTTAAGG - Intronic
1010639746 6:78310082-78310104 CAGATTGTACATGTTTTTCATGG - Intergenic
1012174865 6:96068800-96068822 GTGTTTGTAAATTTTGTCCATGG + Intronic
1013739991 6:113271727-113271749 CTGTTTGTATTTCTTTTTCTTGG - Intergenic
1013941044 6:115662926-115662948 CTGTTAGTCCATCCTTTTCAGGG + Intergenic
1014128982 6:117810110-117810132 CTGTTTTTTCATCTTCTTCATGG + Intergenic
1014295164 6:119608906-119608928 CTGTTTGTGGATCTTGTGAATGG + Intergenic
1016763358 6:147764797-147764819 CTGTTTGCATATCATGTACATGG + Intergenic
1018225398 6:161623313-161623335 CTGTATATACATCTTTTTTAAGG - Intronic
1019864782 7:3697629-3697651 CTTTTTGCACATCTTGCTTAAGG - Intronic
1020236467 7:6359645-6359667 CTGTTTCTCCATCCTGTTCTTGG + Intergenic
1021964592 7:25905249-25905271 ATTTTTGTCCATTTTGTTCAGGG - Intergenic
1022591621 7:31669367-31669389 TTTTTTGTATATCTTGTTTAGGG - Intergenic
1025252933 7:57364027-57364049 ATTTTTGTCCATCTTGTTCTCGG + Intergenic
1025870234 7:65424225-65424247 CTGTTTGGCCATTTTGTGCAGGG - Intergenic
1028171903 7:87607848-87607870 CTGTGTGTATATGTTGTTAAAGG + Intronic
1029932128 7:104383439-104383461 CTGTTTGCATATCTGGTTAAAGG - Intronic
1030201093 7:106905334-106905356 TGGTTTCTACATCTTGTTCTTGG + Exonic
1032314502 7:130822230-130822252 CTTTTTGTTCATCTTGCTCAGGG + Intergenic
1033957742 7:146872744-146872766 CTGTATGCACAAATTGTTCAAGG + Intronic
1035348070 7:158220612-158220634 CTTTTTGTACATGTTGTAAATGG - Intronic
1036651633 8:10647793-10647815 CTGTTTGTACATCTTGTTCATGG - Intronic
1037062714 8:14535125-14535147 CAGTGTGAACATTTTGTTCAGGG + Intronic
1037113274 8:15192255-15192277 CTGTGTTTACATCATCTTCAGGG - Intronic
1039097916 8:33906844-33906866 CTTTATGTTTATCTTGTTCAAGG + Intergenic
1039394085 8:37208115-37208137 ATGTTTGAACAACGTGTTCATGG - Intergenic
1041179982 8:55237014-55237036 CTGGTTGTGCTTCTTCTTCAAGG + Intronic
1042452062 8:68959000-68959022 CTGTTTGTAGATGTTGTCAAAGG - Intergenic
1043819920 8:84850079-84850101 CATTTTGTACATTTTATTCATGG + Intronic
1045132588 8:99172857-99172879 CTGCTTGAACATTTTATTCAAGG + Intronic
1046129723 8:109952435-109952457 CTGTGAGTCCATCTGGTTCAGGG + Intergenic
1046783713 8:118243124-118243146 CTATGTGTACATCTAGCTCAAGG - Intronic
1047822545 8:128537297-128537319 CAGTTTGACCAACTTGTTCAAGG - Intergenic
1048767260 8:137858588-137858610 CTGTGTGTAGATGTTGTTCCTGG + Intergenic
1050034501 9:1421305-1421327 CTGTTCATACACTTTGTTCACGG + Intergenic
1050312714 9:4369767-4369789 CTCTTTTTAGATCTAGTTCATGG - Intergenic
1050573427 9:6966601-6966623 CTGTATGTAGATCTAGTTCTTGG + Intronic
1051602034 9:18884834-18884856 CTCTTTGTTCTTCTTTTTCAAGG + Intronic
1052681145 9:31694648-31694670 CTATTTGTACCTCCTATTCATGG + Intergenic
1055720277 9:79165507-79165529 CTGTTAATATATCTTCTTCATGG - Intergenic
1055793373 9:79947495-79947517 CTGTTTTTACATGTTGTATAGGG + Intergenic
1056123851 9:83514993-83515015 CTGTTTTTTCCTCTTCTTCATGG - Intronic
1056847547 9:90053930-90053952 CCATTTGTCCCTCTTGTTCAGGG - Intergenic
1060565860 9:124591065-124591087 CTGGTTGTACAGCATTTTCAAGG + Intronic
1061229738 9:129308257-129308279 CAGTTTCTCCATCTTGTACATGG - Intergenic
1062369930 9:136233165-136233187 CTGTTTGTCTTTCTTGTTCGAGG - Intronic
1187590308 X:20710401-20710423 GTGTTTTAACATGTTGTTCAAGG + Intergenic
1187908619 X:24089923-24089945 CTCCTTGTACATCTTCATCAGGG + Intergenic
1189521325 X:41771911-41771933 TTATTTGTACCTCTTGTTAAAGG - Intronic
1191974355 X:66854111-66854133 ATGTTTATCCATCTTGTTCAGGG + Intergenic
1192425393 X:71070497-71070519 CTGTTTGTATAATTTGCTCATGG - Intronic
1192762632 X:74109777-74109799 CTGTGAGTCCATCTGGTTCAGGG - Intergenic
1192873218 X:75204720-75204742 CTGTTTGTGCATTTTTTCCAAGG + Intergenic
1192996538 X:76518797-76518819 CTGTTTGTATATCTTCTTTGGGG - Intergenic
1194649083 X:96493565-96493587 ATCTTTGTTCAACTTGTTCATGG - Intergenic
1194799874 X:98259597-98259619 CTGTATGTACACCTTTTACAAGG + Intergenic
1196760138 X:119193598-119193620 CTGTTTTTACATCTTTTAAAAGG - Intergenic
1197015093 X:121615078-121615100 CTGTATGTTCATCTTGGTGATGG - Intergenic
1197303202 X:124806426-124806448 CTGGATGTACATCTTTCTCAAGG - Intronic
1197387935 X:125823541-125823563 CTGTGAGTGCATCTTGTCCAAGG + Intergenic
1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG + Intergenic