ID: 1036651828

View in Genome Browser
Species Human (GRCh38)
Location 8:10649098-10649120
Sequence ATCCGGGAATTTTCTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036651828_1036651830 -8 Left 1036651828 8:10649098-10649120 CCTTCCTTAGAAAATTCCCGGAT 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1036651830 8:10649113-10649135 TCCCGGATTCACCACTCCAGTGG No data
1036651828_1036651836 17 Left 1036651828 8:10649098-10649120 CCTTCCTTAGAAAATTCCCGGAT 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1036651836 8:10649138-10649160 TCGCAAAGCTTTCACAGAGGAGG No data
1036651828_1036651835 14 Left 1036651828 8:10649098-10649120 CCTTCCTTAGAAAATTCCCGGAT 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1036651835 8:10649135-10649157 GATTCGCAAAGCTTTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036651828 Original CRISPR ATCCGGGAATTTTCTAAGGA AGG (reversed) Intronic
903386827 1:22932548-22932570 ATGCTGGAATTTTCTGAGAAGGG - Intergenic
906702761 1:47871885-47871907 ATCAGGGACTTCTCCAAGGAAGG + Intronic
907519625 1:55014717-55014739 ATCCCAGACTTTTCTGAGGATGG - Intergenic
909660400 1:78075846-78075868 ATCTGGGAATTGTGTTAGGAGGG + Intronic
913583176 1:120247309-120247331 TTCCAGTAATTTTCTAAGAATGG - Intergenic
913624996 1:120651021-120651043 TTCCAGTAATTTTCTAAGAATGG + Intergenic
914565165 1:148859127-148859149 TTCCAGTAATTTTCTAAGAATGG - Intronic
914607660 1:149271117-149271139 TTCCAGTAATTTTCTAAGAATGG + Intergenic
915075109 1:153301772-153301794 GTCTTGGAATTTTCAAAGGAAGG - Intronic
915609097 1:156976694-156976716 ATCTGGGACATTTCCAAGGAAGG - Intronic
918092137 1:181306495-181306517 ACCAAGGAATTTTCTAAGCAGGG + Intergenic
1065398901 10:25273357-25273379 ATCCTTGAATATTCTTAGGATGG - Intronic
1074379074 10:112963873-112963895 AGCCGCCAATTTTCTAAGGGAGG - Intronic
1077334675 11:1998005-1998027 ATCCTGGAATTCTCCAAAGACGG + Intergenic
1081320960 11:41690920-41690942 ATCTGGGAATTTCCTAAGAACGG + Intergenic
1202817658 11_KI270721v1_random:53187-53209 ATCCTGGAATTCTCCAAAGACGG + Intergenic
1092738524 12:11606672-11606694 TTGGGGGAAATTTCTAAGGAAGG + Intergenic
1094356443 12:29583009-29583031 ATGCTGGAATATTCTAAAGAAGG + Intronic
1095969781 12:47893735-47893757 TGCCAGGAATTGTCTAAGGAAGG + Intronic
1099388378 12:82047580-82047602 ATCAGGGATTTTTATAAAGATGG - Intergenic
1099848132 12:88055932-88055954 ATTTGGGTATTTTCCAAGGATGG + Intronic
1101834954 12:108288614-108288636 CTCTGGGAATTATCTAAGGCTGG + Exonic
1103222792 12:119259805-119259827 ATCCTTCAGTTTTCTAAGGAAGG + Intergenic
1104543344 12:129687428-129687450 CTCCCGGAATTATCTGAGGAGGG + Intronic
1106969464 13:35120732-35120754 ATCTGGGAAATTTCAAAGAAAGG + Intronic
1107920349 13:45200413-45200435 ATACGGGAGTTTCCTAAGGCAGG - Intronic
1108797801 13:54053207-54053229 CTACGGGAATTCTCTAAGGTTGG + Intergenic
1112131838 13:96533261-96533283 ATCAGGGGTTTTTCTTAGGAGGG - Intronic
1112724237 13:102283593-102283615 ATAAAGGAATTTTCTAAGAATGG - Intronic
1114721849 14:24891093-24891115 CTCCAGGAGTTTCCTAAGGAAGG + Intronic
1115097903 14:29660964-29660986 ATCTTGGAATTTTTTAAAGATGG + Intronic
1116131250 14:40857333-40857355 AACTGTGAAATTTCTAAGGAGGG - Intergenic
1120123559 14:80712960-80712982 GTCAGGGTATTATCTAAGGATGG - Intronic
1124208969 15:27746622-27746644 ATCCTGGAATTTTACAGGGATGG - Intergenic
1125313840 15:38409760-38409782 CTCGGGGAATTTTGAAAGGATGG + Intergenic
1126881881 15:53107914-53107936 ATCCATGAATTTTCTAATAAAGG + Intergenic
1130722867 15:86407020-86407042 ATCTGTGAATTTTCTAAGGAGGG - Intronic
1202952180 15_KI270727v1_random:50439-50461 ATCAGGGAGCTTTGTAAGGATGG + Intergenic
1132741899 16:1418287-1418309 CTCCTGGAGTTTTCAAAGGATGG - Intergenic
1144481406 17:15632508-15632530 CTCCAGGAGTTTTCCAAGGAAGG - Exonic
1144916895 17:18731214-18731236 CTCCAGGAGTTTTCCAAGGAAGG + Exonic
1147817911 17:43223644-43223666 ATCCAGCAGTTTTCCAAGGATGG + Intergenic
1149257869 17:54847739-54847761 ATTAGGAAATTTTCTAAGAAAGG + Intergenic
1149330391 17:55575609-55575631 AACAGGGATTTTTCTAAGCAGGG + Intergenic
1149674223 17:58445082-58445104 TTCCTGGATTTTTTTAAGGAAGG - Intronic
1151763172 17:76118897-76118919 ATCCAGGACTTTTTTTAGGAGGG - Intronic
1152062288 17:78086693-78086715 ACCCAGGAATTTTCAAAGGAAGG - Intronic
1153086620 18:1295766-1295788 TTTCAAGAATTTTCTAAGGACGG - Intergenic
1160254183 18:77233552-77233574 ATCCGGGTTTTTTCTGAGGATGG + Intergenic
1166420569 19:42633080-42633102 ATCCGGAAACTTTCTGAGCATGG + Intronic
1166421140 19:42637367-42637389 ATCTGGGGATTTTCAAAGCACGG - Intronic
1166496136 19:43304580-43304602 ATCCGGAAAGTTTCTGAGCAGGG + Intergenic
1167922638 19:52794550-52794572 ATCCTGGAATTTTCTAGAGAAGG - Intronic
1167960354 19:53099936-53099958 ATCCTGGAATTTTCCAGGGGAGG - Intronic
927470782 2:23374733-23374755 ATCAGGGAATTTAATGAGGATGG + Intergenic
928987332 2:37194574-37194596 ATCCGGAAATTTTGCAATGAAGG - Intronic
933144256 2:78831879-78831901 AGCAGAGACTTTTCTAAGGATGG + Intergenic
936040643 2:109146751-109146773 ATCCGCAAGTTTTCGAAGGAAGG - Intronic
936238944 2:110770385-110770407 ATCCTGGAGTCTTCTCAGGAAGG + Intronic
937413619 2:121697357-121697379 TTCAGGGACCTTTCTAAGGAAGG + Intergenic
937740826 2:125351037-125351059 CTGCGGGAATTTTCTAACAATGG - Intergenic
938664697 2:133522432-133522454 ATCCAGGTATTTCCCAAGGAAGG - Intronic
944998155 2:205318250-205318272 CTCCTGGAATTTTCAAAGTATGG + Intronic
947458567 2:230282210-230282232 CTCTGGAAAATTTCTAAGGAGGG + Intronic
947468805 2:230381263-230381285 CTCTGGAAAATTTCTAAGGAGGG + Intronic
1172077538 20:32310835-32310857 TTCCTGGAATTCTCGAAGGAGGG - Exonic
1176686923 21:9857333-9857355 ATGTGGGAATTTTCTCAGCAAGG - Intergenic
1182424055 22:30263008-30263030 ATCCTGGAATTTTCTCACGCAGG - Exonic
952116227 3:30184742-30184764 ATCCAGGAATTTTGTGAAGAGGG - Intergenic
952355695 3:32581755-32581777 ATCCTGGGATTTACTAAGGAAGG - Intergenic
952612117 3:35224476-35224498 ATCTGGAAATTTTCCAAGGAGGG - Intergenic
958724317 3:97885975-97885997 ATGAGGGAAATTTTTAAGGAAGG + Intronic
964988557 3:162775164-162775186 ATCCGTGCATTTTCCAAAGAGGG - Intergenic
967094613 3:186166893-186166915 ACCAGGGAATGTTTTAAGGAGGG - Intronic
969404578 4:6981416-6981438 ATCCTGGAATTTATTAAAGAAGG + Intronic
970160368 4:13182171-13182193 ATCCAGGAATTTTCAGAGTAGGG - Intergenic
971854698 4:32028088-32028110 ATCTATGAATTTTCTATGGATGG - Intergenic
975514630 4:75232889-75232911 TTGCTGGAATTTTCCAAGGATGG + Intergenic
975546688 4:75567802-75567824 ATTCGGGAAGTTTGTAGGGAAGG + Intergenic
996700176 5:126443069-126443091 ATCCAGCAATCTTCTAAGGAGGG - Intronic
997128325 5:131251382-131251404 ATCAGGGAATTTTCTAAATGGGG - Intronic
997346131 5:133193764-133193786 ATCCGAGAGTTTTCTGAGGTGGG + Intergenic
997555555 5:134795022-134795044 AACTGGGAATTTCCTAAAGATGG - Intronic
998363587 5:141613082-141613104 ATCTGGGAATTTTGTTAGGGTGG - Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1012425311 6:99107650-99107672 ATCAGGGAAATTTTTATGGAAGG + Intergenic
1013880142 6:114888351-114888373 ATCCCTGAAGTTTCTAAGCAAGG - Intergenic
1019797316 7:3060405-3060427 TTCCGGGAATTTTCTATAAATGG + Intergenic
1027854797 7:83497041-83497063 ATCCGGAAATTTTCTAAAGAGGG + Intronic
1030909730 7:115232089-115232111 ATCTTGGAATTTTCTAAATAGGG + Intergenic
1031270185 7:119639172-119639194 ATCCAGGGATTTTTCAAGGAGGG + Intergenic
1036651828 8:10649098-10649120 ATCCGGGAATTTTCTAAGGAAGG - Intronic
1037078320 8:14750464-14750486 ATCTAAGAGTTTTCTAAGGAAGG + Intronic
1038375540 8:27036629-27036651 ATCGGGTGATTTTCTGAGGAGGG + Intergenic
1040316306 8:46262730-46262752 ATCCTGGAAGTTTCTCAAGAAGG + Intergenic
1043373090 8:79615203-79615225 ATCCGGAATTTTCCTAAAGATGG - Intronic
1046893374 8:119447379-119447401 ATCCTGGAATTTACTAAAGATGG + Intergenic
1050344694 9:4674837-4674859 TTCCAGGAATCTTCCAAGGAAGG + Intergenic
1054170353 9:61834386-61834408 ATGTGGGAATTTTCTCAGCAAGG + Intergenic
1054667184 9:67746429-67746451 ATGTGGGAATTTTCTCAGCAAGG - Intergenic
1061217932 9:129232494-129232516 AACCAGGGATTTTCTCAGGAAGG - Intergenic
1061232421 9:129322427-129322449 AACTGGGAACTTTCTTAGGAGGG - Intergenic
1189171941 X:38917521-38917543 ATCCAGGCATTTTCTAAGAAAGG - Intergenic
1195461874 X:105136632-105136654 ATACTGTAATTTTCTAATGATGG - Intronic
1197171316 X:123437551-123437573 ATCCTGGAATGTTTAAAGGAAGG + Intronic