ID: 1036654615

View in Genome Browser
Species Human (GRCh38)
Location 8:10670119-10670141
Sequence GAGGCTGGACAGCCACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036654609_1036654615 14 Left 1036654609 8:10670082-10670104 CCAAGGCCAGTGTGGGCCGGAGA 0: 1
1: 0
2: 3
3: 20
4: 194
Right 1036654615 8:10670119-10670141 GAGGCTGGACAGCCACATGAAGG No data
1036654612_1036654615 -2 Left 1036654612 8:10670098-10670120 CCGGAGAAGAAAAGGTCACATGA 0: 1
1: 0
2: 1
3: 30
4: 261
Right 1036654615 8:10670119-10670141 GAGGCTGGACAGCCACATGAAGG No data
1036654610_1036654615 8 Left 1036654610 8:10670088-10670110 CCAGTGTGGGCCGGAGAAGAAAA 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1036654615 8:10670119-10670141 GAGGCTGGACAGCCACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036654615 Original CRISPR GAGGCTGGACAGCCACATGA AGG Intronic
No off target data available for this crispr