ID: 1036659330

View in Genome Browser
Species Human (GRCh38)
Location 8:10697861-10697883
Sequence GGCCACACTGACGGAGGCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036659323_1036659330 20 Left 1036659323 8:10697818-10697840 CCGAGGGCATGGACAGGGACTTG 0: 1
1: 0
2: 2
3: 25
4: 248
Right 1036659330 8:10697861-10697883 GGCCACACTGACGGAGGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 214
1036659327_1036659330 -8 Left 1036659327 8:10697846-10697868 CCACGAGCAGCAGGTGGCCACAC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1036659330 8:10697861-10697883 GGCCACACTGACGGAGGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 214
1036659319_1036659330 28 Left 1036659319 8:10697810-10697832 CCCGCTGGCCGAGGGCATGGACA 0: 1
1: 0
2: 1
3: 21
4: 165
Right 1036659330 8:10697861-10697883 GGCCACACTGACGGAGGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 214
1036659320_1036659330 27 Left 1036659320 8:10697811-10697833 CCGCTGGCCGAGGGCATGGACAG 0: 1
1: 0
2: 1
3: 24
4: 357
Right 1036659330 8:10697861-10697883 GGCCACACTGACGGAGGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036659330 Original CRISPR GGCCACACTGACGGAGGCCG AGG Exonic