ID: 1036659334

View in Genome Browser
Species Human (GRCh38)
Location 8:10697897-10697919
Sequence CGACGTGCTGCTCCTGAAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036659332_1036659334 -4 Left 1036659332 8:10697878-10697900 CCGAGGCACAGAAGCGCGCCGAC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1036659334 8:10697897-10697919 CGACGTGCTGCTCCTGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 71
1036659331_1036659334 11 Left 1036659331 8:10697863-10697885 CCACACTGACGGAGGCCGAGGCA 0: 1
1: 1
2: 5
3: 261
4: 1098
Right 1036659334 8:10697897-10697919 CGACGTGCTGCTCCTGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 71
1036659327_1036659334 28 Left 1036659327 8:10697846-10697868 CCACGAGCAGCAGGTGGCCACAC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1036659334 8:10697897-10697919 CGACGTGCTGCTCCTGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036659334 Original CRISPR CGACGTGCTGCTCCTGAAAG AGG Exonic