ID: 1036659800

View in Genome Browser
Species Human (GRCh38)
Location 8:10700587-10700609
Sequence CAGAGACCAGATGATGGCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036659800 Original CRISPR CAGAGACCAGATGATGGCAT GGG (reversed) Exonic
903954430 1:27015294-27015316 CAGAGTCAACCTGATGGCATTGG - Intergenic
905999569 1:42412683-42412705 TAGAAACCAGATGATGACTTTGG + Intronic
909664704 1:78120390-78120412 CAGAAACCTAATGATGGCAAGGG - Intronic
909935961 1:81550958-81550980 CTGAGACATGATGATGTCATGGG + Intronic
910359178 1:86397231-86397253 GAGAGACCAGATGAAGGTAATGG + Intergenic
913276008 1:117138308-117138330 TAGAAACCAGATGATGACTTTGG - Intergenic
913539488 1:119805237-119805259 CAGAGGGCAGATAATGACATGGG + Intronic
914867223 1:151441466-151441488 TTGAGACCTGAAGATGGCATTGG - Intronic
916429453 1:164712991-164713013 TAGAGGCCAGATGATGGGTTAGG + Intronic
920170760 1:204071174-204071196 CAGTGACCAGACAATGGCAGTGG - Intergenic
920297981 1:204971040-204971062 CAGAGCCCAGTTGATGGCCTGGG + Intronic
921917754 1:220631644-220631666 CTGAGACTAAATGATGGCTTTGG - Intronic
923522115 1:234743243-234743265 CAGAGCCGAGATGAAGGAATAGG - Intergenic
924039526 1:239970942-239970964 CAGAAACAAGAGGATGGCAGGGG + Intergenic
924131557 1:240914674-240914696 CAGAGAGCAGATGTTTGCAAGGG - Intronic
1063381280 10:5587745-5587767 CAGAGGCCTGATGCTGGCAGGGG + Intergenic
1063513604 10:6671826-6671848 CAGAGAACAGATAATAACATTGG - Intergenic
1064048870 10:12043024-12043046 CAGAGTCAAGCTGAGGGCATCGG - Intronic
1064852279 10:19722239-19722261 CAGAGACAAGATGATTGCAAGGG + Intronic
1065694328 10:28366056-28366078 CAGAGAACAGATGATAGTTTGGG + Intergenic
1067088517 10:43255071-43255093 CAGAGACCAGGTGGTGGCTGGGG - Intronic
1067289297 10:44929686-44929708 CAGAGGCCAGAATATGGCACAGG - Intronic
1070440318 10:76436567-76436589 CAGTGACAAGATGCTGGCTTTGG + Intronic
1071229712 10:83571383-83571405 CAGAGAGCAGGTGAAGGCACAGG - Intergenic
1071439590 10:85678543-85678565 CAGAGACCACATGAGGGGATGGG - Intronic
1072394738 10:95026918-95026940 CACAGACCAGAAGATTCCATTGG - Intergenic
1073496775 10:103898799-103898821 CTGAGCCCAGATGCTGGGATCGG - Intronic
1073623780 10:105075456-105075478 CAGGGACCAGAGGATGGAACAGG - Intronic
1074564753 10:114567249-114567271 CAGGGACCGGAACATGGCATCGG + Intronic
1074844771 10:117388031-117388053 CAGAGCCCAGATTAAGGCAGTGG + Intergenic
1074975536 10:118578177-118578199 CAGATGCTAGAAGATGGCATTGG + Intergenic
1076408783 10:130231363-130231385 CAGAGACGTGACGATGGCAGAGG - Intergenic
1076814923 10:132909889-132909911 CAGAGCCCAGATGTGGGCAGGGG + Intronic
1077305588 11:1867406-1867428 CAGAGAAGAGATCATGGCAGTGG - Intronic
1077360081 11:2137013-2137035 CAGAGACCAGGTGGGGGCAGGGG + Intronic
1079266361 11:18936865-18936887 CAGGGACCAGGGGCTGGCATTGG - Intronic
1080614870 11:33937150-33937172 CATAGACCAGATTAAGGAATTGG + Intergenic
1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG + Intronic
1083989253 11:66236664-66236686 CAGAGGCCAGAGCATGGCACCGG + Intronic
1084626622 11:70312752-70312774 CGCAGCCCAGATGATGGCAATGG - Intronic
1086162491 11:83738028-83738050 AAGAGATGAGAGGATGGCATTGG + Intronic
1086468811 11:87084898-87084920 ATTAGAACAGATGATGGCATAGG - Intronic
1087826249 11:102767965-102767987 CAGGGACCAGACGCTGGCTTTGG - Intergenic
1088665935 11:112093727-112093749 CAGAGATCAGAGGAAGGCAGGGG - Intronic
1094429995 12:30358012-30358034 GAGAGACCACATGTAGGCATCGG + Intergenic
1096458051 12:51803634-51803656 CAGAGAGAAGATGATGGCTGAGG - Intronic
1096614929 12:52826823-52826845 CCAAAACCAGATCATGGCATTGG + Intronic
1096938271 12:55308499-55308521 CAGACAACAGATGCTGGCAAGGG + Intergenic
1099415116 12:82374910-82374932 CTGAGACAAGGTGATGGCAGTGG + Intronic
1099864632 12:88264245-88264267 CAGAGAACACGTGATGGCAGAGG + Intergenic
1100575040 12:95883124-95883146 CCTAAACCAGATAATGGCATCGG - Intronic
1100875031 12:98952753-98952775 CAGAGAGCAGATGATGAGTTTGG - Intronic
1101299281 12:103461362-103461384 TAGAGGACAGATGATGTCATGGG + Intronic
1101693458 12:107102488-107102510 CAAAGACCAGATGGGGACATGGG + Intergenic
1101712987 12:107286054-107286076 CAGAGACCAGAGGATAGAACAGG + Intergenic
1101806607 12:108069609-108069631 CAGAGAACAGATGAGGTCATGGG - Intergenic
1101813960 12:108130923-108130945 CAGAGACCAGGTGATCTCCTTGG - Intronic
1102740596 12:115204049-115204071 CAGAGAGAAAATGAAGGCATGGG - Intergenic
1102860687 12:116333719-116333741 CAGATGCCAGATGATGGGATTGG + Intergenic
1104384563 12:128339175-128339197 CACAGACCACATGCTGGCAGTGG - Intronic
1105733705 13:23246189-23246211 CAGAGACCTGAAGATGACAGAGG + Intronic
1107619547 13:42212068-42212090 CAGTGACCAGATGAAGGTGTGGG - Intronic
1107885119 13:44868714-44868736 CAGAAACTAAATGATGGCAATGG - Intergenic
1110874741 13:80494553-80494575 CAGAGATCACATGATGAGATAGG - Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1113004164 13:105679640-105679662 TAGAGAACAGAAGATGTCATTGG - Intergenic
1113128797 13:107011265-107011287 CTGGGACCAGAGGATGGCAACGG - Intergenic
1113433030 13:110266565-110266587 CGGAGACCAGATGCTGACTTGGG + Intronic
1115074085 14:29364070-29364092 AAGACACAAGATGAAGGCATAGG + Intergenic
1116639616 14:47444381-47444403 GAGAAACCAGATGATGGCTCTGG + Intronic
1116868900 14:50053266-50053288 GAGAAACCAGATGATGATATTGG - Intergenic
1116987003 14:51231235-51231257 ATGAGACAAGATGATGGCTTGGG + Intergenic
1117508689 14:56427302-56427324 CAGAGCCCAGATGAGGGTATGGG - Intergenic
1118121146 14:62844582-62844604 CAAAGCCCAGATGATGGATTTGG + Intronic
1118357592 14:65027478-65027500 CAGAGCCCAGAAGGTGGCTTTGG + Exonic
1118491342 14:66263604-66263626 AAGAAACAAGATGCTGGCATTGG - Intergenic
1118813208 14:69290482-69290504 CTGAGACAAGATGTTGGCAGGGG + Intronic
1122124707 14:99572680-99572702 CAGAAAACAGATGGTGGCAGGGG - Intronic
1122481408 14:102049784-102049806 CAGGGACCAGCTGTTGGCCTGGG - Exonic
1122798526 14:104218305-104218327 CAGAGCCCACATGGTGGCAGCGG + Intergenic
1124905854 15:33867797-33867819 AAGAGAACTGATGATGGCAAGGG - Exonic
1127284417 15:57519950-57519972 CACAGAACAGGTGATGGCCTTGG + Intronic
1127593627 15:60454466-60454488 TAGAGACAAAATGATGGCATAGG - Intronic
1133289756 16:4711910-4711932 AAGAGACCAGATGGTTTCATGGG + Intronic
1134342932 16:13361729-13361751 GAGAGTGGAGATGATGGCATGGG - Intergenic
1134622473 16:15699968-15699990 CAGAGCACAGGTGATGGCCTCGG - Intronic
1135567656 16:23524287-23524309 CAGAGACCAGAAGGAGGCCTGGG - Exonic
1137706759 16:50540779-50540801 CTTAGACCAGGTGATGGCAGTGG - Intergenic
1142312036 16:89319817-89319839 GAGAGACCAGATGAGGACAGAGG + Intronic
1144752319 17:17657741-17657763 CAGAGGCCAGAGGTTGGCACTGG - Intergenic
1145873077 17:28292648-28292670 CAGTGACAAGATATTGGCATTGG + Intergenic
1146890821 17:36505448-36505470 CAGAGCCCAGTTGATGGCCCTGG - Intronic
1149000051 17:51748007-51748029 CATAAACCACATGATGGCTTAGG + Intronic
1149239073 17:54627466-54627488 CAGAGACCAGGTAATGGTTTAGG - Intergenic
1149755598 17:59182908-59182930 CAGAGTCCAGAAGAAGGCCTTGG - Intronic
1151010335 17:70485920-70485942 AAGAAAACAGATTATGGCATAGG - Intergenic
1151700115 17:75738313-75738335 CAGAGAACGGATGCTGGCAAGGG - Intronic
1152514667 17:80816339-80816361 CAGAGAGCAGCTGAGGGCCTGGG + Intronic
1153191757 18:2548621-2548643 CAGGGTCCAGGTTATGGCATTGG - Intronic
1153573738 18:6499575-6499597 CAAACAACAGATGTTGGCATGGG - Intergenic
1153896171 18:9562932-9562954 CAGAGTCCAGATAATGTCACTGG + Intronic
1156332960 18:36142203-36142225 CTGAGACCAAATGATGTCACTGG + Intronic
1156708555 18:39913463-39913485 CAGTGACTAGATGAATGCATGGG + Intergenic
1158038873 18:53069004-53069026 CTGAGACAACATGGTGGCATGGG + Intronic
1159035379 18:63272265-63272287 CAGAAACCAGATCCTGGCTTGGG - Intronic
1159542453 18:69795284-69795306 TAGACACCAGACGATGGCAAAGG + Intronic
1160015037 18:75133893-75133915 TAGTGGCCAGATGATGGCTTCGG - Intergenic
1160992832 19:1867195-1867217 CAGAGGACAGATGAGGGCAGAGG + Intergenic
1162396005 19:10418459-10418481 CGGTGACCAGAGGAGGGCATGGG - Intronic
1162863696 19:13527492-13527514 CAGAGACCACATGATGACAGAGG + Intronic
1163349924 19:16770084-16770106 GAGAAAACAGATGATGCCATTGG - Intronic
1163364284 19:16867574-16867596 CAGTGCCCAGATCATGGCACGGG + Intronic
1164702040 19:30292430-30292452 CTGAGACAAGAGGATGGCTTGGG - Intronic
1164754841 19:30681782-30681804 CAGAGACCAGAGGGTGGAACTGG - Intronic
1164807841 19:31130544-31130566 CACAAAACAGATGAAGGCATGGG - Intergenic
1167744370 19:51342011-51342033 CAGAGAAGAGAGGAAGGCATTGG + Intronic
1168060949 19:53891898-53891920 CAGAGAGCAGCTGATGGGAGGGG + Intronic
925853892 2:8110781-8110803 TAGAGCCCACATGATGGAATTGG + Intergenic
926833258 2:16988507-16988529 CAGAGATCAGATCATGGTACAGG - Intergenic
927304661 2:21556713-21556735 CAGAAACCACATGAGAGCATTGG + Intergenic
928835711 2:35541838-35541860 CAGAGACCAGAGGATGGTAGAGG + Intergenic
929670865 2:43875758-43875780 CAGAGACCAGGCTATGGCAGTGG - Intronic
930105548 2:47636304-47636326 CAGACACCAGATCATCTCATGGG + Intergenic
930187791 2:48427561-48427583 CAGACAAGAGATGATGGCAGTGG + Intergenic
932090956 2:68805859-68805881 CAGAGCCCTGATTATGGCAGAGG + Intronic
932569098 2:72928406-72928428 CAAAGGTCAGATGATAGCATAGG + Intronic
933025529 2:77252921-77252943 CAACGACCATATGAAGGCATAGG - Intronic
936591870 2:113812047-113812069 GAGAGAACAGGTGATGTCATGGG + Intergenic
937457868 2:122058515-122058537 CAGACACAAGGTGATGGCACAGG + Intergenic
939544366 2:143534518-143534540 CAGAGATCTGATGATTTCATGGG + Intronic
940345238 2:152621890-152621912 CAGAGGCCAAGTGATGTCATAGG - Intronic
943932320 2:193869162-193869184 GAGAGACCTGGTGATGTCATGGG - Intergenic
944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG + Intronic
945819370 2:214645169-214645191 CTGAGATCAGATGCTGGAATCGG + Intergenic
948291192 2:236826140-236826162 CAGGAATCAGATGATGGCCTAGG - Intergenic
1172722144 20:37007235-37007257 CAGAGACCAGAGGAAATCATGGG - Intronic
1172791320 20:37507368-37507390 CAGAGAGGAGATGATTGCCTTGG - Intronic
1174183066 20:48687066-48687088 CTGGGGCCCGATGATGGCATTGG - Intronic
1175787415 20:61720634-61720656 CAGACACAAGACGATGGCTTAGG - Intronic
1180561581 22:16619655-16619677 CAGAGGGCAGAGGATGGGATGGG - Intergenic
1181317039 22:21977677-21977699 CACACAGCAGATGAGGGCATGGG + Intronic
1182010690 22:26998496-26998518 GAGTGACCCCATGATGGCATGGG + Intergenic
1183315914 22:37136692-37136714 CAGAGACCAGCTGCAGGCTTGGG - Intronic
1184138931 22:42566317-42566339 CAGAGACCAGAGGCTCGCCTGGG + Exonic
1184969915 22:48010805-48010827 CAAAGCCCAGATGATGGCATTGG - Intergenic
950396046 3:12734802-12734824 CAAAGACCACAGGATGGCATGGG + Intronic
954363424 3:50134224-50134246 CAGAGACCAGATGATTTGTTTGG + Intergenic
956777510 3:72577740-72577762 CAGGGAGCAGCTGATGGCCTTGG - Intergenic
958690424 3:97459109-97459131 GAGGGACCAGATGAGGGAATTGG + Intronic
959611987 3:108305530-108305552 AAGGGACTAGATGATGACATTGG - Intronic
959705142 3:109332529-109332551 CAGAATCCAGGTGGTGGCATCGG + Intronic
962488645 3:135869021-135869043 CAGAGACCAGGTGATGCCACAGG - Intergenic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
964093666 3:152905959-152905981 CAGAGACAAGATGATTTCTTTGG + Intergenic
971069643 4:23076997-23077019 CACTGACCTGCTGATGGCATAGG - Intergenic
971607177 4:28672592-28672614 CAGACACCAGACAATTGCATTGG + Intergenic
972232741 4:37094250-37094272 CAGATTCGAGATGATGTCATTGG - Intergenic
972331711 4:38069985-38070007 CACAGCCCAGATAATGGCCTAGG - Intronic
972571565 4:40315481-40315503 AAGGGAACAGATGATGGCAAAGG - Intergenic
976140571 4:81987234-81987256 TAGAGACAAAAGGATGGCATTGG + Intronic
978154268 4:105472244-105472266 CAGAGCCAAGATTATGGCCTAGG + Intronic
981824493 4:148924600-148924622 AAGGGACCAGATGATGCTATTGG + Intergenic
981966601 4:150611126-150611148 CAGAGACCATCTGAAGGCTTAGG + Intronic
982058997 4:151584195-151584217 GAGAGACCATATGAAGTCATGGG - Intronic
986144753 5:5066721-5066743 CTGGGCCCAGATGATGTCATTGG + Intergenic
986989051 5:13530445-13530467 CAGAGAACAGATAATAGCTTGGG + Intergenic
992044681 5:72874423-72874445 CAAATGCAAGATGATGGCATTGG + Intronic
993166743 5:84365557-84365579 CAGAGACCACCTGATGACTTAGG + Intronic
995439949 5:112180353-112180375 CCGAGACAACATGATGGCTTAGG + Intronic
997626572 5:135335301-135335323 CAGTGCCCAGAAGATGGGATGGG + Intronic
998589965 5:143466624-143466646 CCAAGACCAGATGATTTCATTGG - Intergenic
999049785 5:148509938-148509960 CACAGAGCAGGTGATGGCGTAGG + Exonic
999081694 5:148850335-148850357 CAGAGAAAACAGGATGGCATAGG + Intergenic
999112187 5:149131356-149131378 CAGAGGCTAGATGGTGACATAGG - Intergenic
999206265 5:149850381-149850403 CAGAGACCTGAGCGTGGCATTGG + Exonic
999256657 5:150213374-150213396 CAGAGACCACACGTTGGCAGTGG - Intronic
999893227 5:156001129-156001151 CAGAAACAAGATGATGAGATGGG - Intronic
1001019574 5:168171927-168171949 CAGAGACCGGGGGATGGCAAGGG - Intronic
1001304575 5:170562354-170562376 CAGAGACCACATGACTGCATGGG + Intronic
1001809315 5:174615212-174615234 CAGCAACCAAATGATGACATTGG - Intergenic
1002081897 5:176742326-176742348 CAGGCACCAGGTGGTGGCATTGG + Intergenic
1002465880 5:179408149-179408171 CAGAGGCCTGATGAGGGCACAGG + Intergenic
1003761914 6:9188299-9188321 GAGAGACAAGATGAAGCCATAGG + Intergenic
1004055543 6:12134321-12134343 CCGAGACCAGATGATGGCTAAGG - Intronic
1004846208 6:19645389-19645411 CATAGAGCACATGATGGCCTGGG - Intergenic
1006182540 6:32162986-32163008 CAGAGACCAAGTGGTGGCCTTGG + Exonic
1007477699 6:42130019-42130041 CAAAGCCCAGATGCTCGCATGGG - Intronic
1010585807 6:77657773-77657795 CAGAGAGCATATAATGGCATAGG - Intergenic
1012587262 6:100939119-100939141 CTGAGGCCAGATGGTGGTATTGG + Intergenic
1013695121 6:112692869-112692891 CAGAGACCAGATGACACCAGTGG - Intergenic
1014764552 6:125391853-125391875 CAGTGACCAGGTGATGGAAATGG - Intergenic
1016660809 6:146577374-146577396 CAAAGATCAGTTGATGGTATAGG - Intergenic
1017549836 6:155494249-155494271 CAGTGACCAAAAGAAGGCATTGG + Intergenic
1018205784 6:161436125-161436147 CAGAGAGCAGAGGCTGGGATGGG + Intronic
1018205810 6:161436206-161436228 CAGAGAGCAGAGGGTGGGATGGG + Intronic
1020045600 7:5037882-5037904 CAGAGTCCAGAAGAAGGCCTTGG - Intronic
1020290999 7:6722075-6722097 CAGAGTCCAGAAGAAGGCCTTGG - Intergenic
1022472056 7:30688184-30688206 GAGAGACCATATGAAGACATAGG + Intronic
1024505490 7:50158456-50158478 CAGAGGCCAGAAGAAGACATCGG - Intronic
1024513722 7:50224820-50224842 CTGAAACTAGATGATGGCAATGG + Intergenic
1026776062 7:73231729-73231751 CAGAGAGGAGAAGATGGGATGGG + Intergenic
1026836152 7:73640803-73640825 AAAAGAACAGATGATGGCATGGG + Intergenic
1027016919 7:74785100-74785122 CAGAGAGGAGAAGATGGGATGGG + Intronic
1027071108 7:75160836-75160858 CAGAGAGGAGAAGATGGGATGGG - Intergenic
1027709390 7:81579580-81579602 CACAGCCCAGATGATGGAAGAGG + Intergenic
1029967323 7:104753614-104753636 CAAAGACCAGATGATAGATTGGG + Intronic
1031959153 7:127973344-127973366 CAGAGAGCAAATGATTGCCTAGG + Intronic
1033289680 7:140072715-140072737 CAGTCACCAGAAGCTGGCATAGG + Intergenic
1033303979 7:140210831-140210853 CAGAGGCCAGGAGAGGGCATGGG + Intergenic
1035989508 8:4473331-4473353 CAGAGACAACCTGATGCCATTGG + Intronic
1036013260 8:4751805-4751827 CAGAGTCCACATGATGTCTTCGG + Intronic
1036635928 8:10549426-10549448 CAGAGGGTGGATGATGGCATCGG + Intronic
1036659800 8:10700587-10700609 CAGAGACCAGATGATGGCATGGG - Exonic
1037535612 8:19821111-19821133 CAGACGCCAGAAAATGGCATGGG - Intronic
1037553318 8:19996396-19996418 CAGAGAGCATAGGATGGCAGGGG + Intergenic
1038060274 8:23904662-23904684 TTGAGGCCAGATGATGCCATTGG - Intergenic
1038080165 8:24125827-24125849 CAGAAGTCAGATGATGGAATTGG - Intergenic
1038368885 8:26967836-26967858 CAGAGACCAGATAACAGCACAGG - Intergenic
1038419175 8:27421206-27421228 TAGGGACCAGATGATATCATTGG + Intronic
1038959676 8:32505415-32505437 CAAAGACCAGATGATGGAACTGG - Intronic
1041536212 8:58927970-58927992 CAGAAACCTACTGATGGCATTGG - Intronic
1041592151 8:59600750-59600772 CACAAACCAGATGAAGCCATGGG - Intergenic
1042947755 8:74172021-74172043 CAGAGAAGAGATGAGGGCATAGG + Intergenic
1044408649 8:91860291-91860313 CAGAGTTCAGAGGATCGCATGGG + Intergenic
1047582382 8:126230424-126230446 TAAAGAACAGATGAAGGCATAGG + Intergenic
1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG + Intronic
1048951730 8:139502073-139502095 CAGATACCAGATGAAGCCGTGGG - Intergenic
1051347103 9:16162127-16162149 CAGACACCACATGAAGCCATTGG + Intergenic
1052083483 9:24235703-24235725 CAGAGTCCAGTAGATGGCAAAGG - Intergenic
1055151677 9:73008237-73008259 CAGAGCCCAGATGCTGGGAGGGG + Intronic
1055666462 9:78557938-78557960 CAGAGTTCAGATGGTGGCAAAGG - Intergenic
1056634428 9:88320129-88320151 CTGAGTCCAGATGCTGGCCTTGG - Intergenic
1057062393 9:92017218-92017240 CTGACACCAAATGATGCCATGGG - Intergenic
1059428970 9:114238689-114238711 CAGCGACCAGAGGAGGGAATTGG - Intronic
1060230172 9:121820108-121820130 CCGCCTCCAGATGATGGCATGGG + Intergenic
1061459930 9:130729379-130729401 CTGAGAGAAGATGAGGGCATGGG - Intronic
1061480742 9:130896640-130896662 CAGAGACCTGAGGAAGGCACTGG + Intergenic
1187458218 X:19461524-19461546 CAAATACCAGATAATAGCATTGG - Intronic
1187866871 X:23730967-23730989 CAGAGACCATGTGAAGGCAATGG - Exonic
1188317460 X:28692033-28692055 CAGAGACCACATGATGAGAGAGG + Intronic
1191108644 X:56788401-56788423 CACAAAACAGATGGTGGCATGGG + Intergenic
1191715076 X:64188625-64188647 CAGAGTCCAAATGATGGGATGGG + Exonic
1192412478 X:70946392-70946414 AAGATACCAGATGCTGGGATTGG - Intergenic
1196721976 X:118862983-118863005 CAGAGAGCAGAGGATGCCAGAGG - Intergenic
1197768741 X:130075671-130075693 AATAGACCAGCTGATGGCAAGGG + Intronic