ID: 1036659853

View in Genome Browser
Species Human (GRCh38)
Location 8:10700917-10700939
Sequence ATGGCTCTGGGTCCTCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036659853_1036659864 24 Left 1036659853 8:10700917-10700939 CCCACAAGAGGACCCAGAGCCAT 0: 1
1: 0
2: 1
3: 19
4: 156
Right 1036659864 8:10700964-10700986 CCAGGAGCATCTGCACTGTCTGG No data
1036659853_1036659860 6 Left 1036659853 8:10700917-10700939 CCCACAAGAGGACCCAGAGCCAT 0: 1
1: 0
2: 1
3: 19
4: 156
Right 1036659860 8:10700946-10700968 TCTAGAAAACTCTTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036659853 Original CRISPR ATGGCTCTGGGTCCTCTTGT GGG (reversed) Intronic
900627494 1:3615670-3615692 GTGGCTCAGGGCCCTCTTGCAGG - Intergenic
901625012 1:10618919-10618941 ATGGCTCTGAGTCCTCTACAAGG - Intronic
902717187 1:18280883-18280905 AGGGCTCAGGGTCCCCTTCTGGG + Intronic
903184159 1:21619986-21620008 ATGGCTCTGTGGCCTGTTCTGGG - Intronic
903337088 1:22632341-22632363 ATGTGTCAGTGTCCTCTTGTAGG - Intergenic
906096610 1:43228477-43228499 ATGGCTCTGGCACTTCTAGTTGG - Intronic
907358288 1:53894243-53894265 GAGGCTCTGGGTGCTCTTGGAGG + Exonic
908607275 1:65812284-65812306 AAATTTCTGGGTCCTCTTGTAGG + Intronic
909363386 1:74791330-74791352 ATGTCTCTGGCTCCTTTTGCAGG - Intergenic
911835787 1:102617126-102617148 ATGGCTTTGAGTGCTCTTCTTGG - Intergenic
914386761 1:147177094-147177116 AGGGCTCTGGTTCCCTTTGTTGG - Intronic
914460872 1:147883764-147883786 ATGCTTCTGGGTCCTGTTGTTGG - Intergenic
917783083 1:178420539-178420561 CTGGCTTTTGGTCCTCTTGATGG - Exonic
917890115 1:179428514-179428536 ATGGCCCAGGGACCCCTTGTGGG + Intronic
918817870 1:189212693-189212715 ATGGCACTAGGTTCTCTTGTAGG - Intergenic
920543173 1:206794519-206794541 TTGGCCCCGGGTCCTCCTGTTGG + Intergenic
922898677 1:229119856-229119878 AGGTCGCTGTGTCCTCTTGTTGG - Intergenic
923316443 1:232785029-232785051 AGGGCTCTGAGTTCTCTTGAAGG + Intergenic
924335086 1:242979543-242979565 GTGGCTCTGGGGCTTCTTTTGGG + Intergenic
1063116363 10:3074599-3074621 AAGTCTCTGGGTCCCCTTGGCGG - Intronic
1064272843 10:13880613-13880635 ATGGCTCTGGGACCTCTCCTGGG + Intronic
1065721052 10:28629170-28629192 AGGGCTCTGGGTCAGCTTGCTGG - Intergenic
1065903561 10:30228782-30228804 TTGCCTCCGGGACCTCTTGTTGG + Intergenic
1066461243 10:35614202-35614224 ATGGATCTGGGTATTCTAGTAGG + Intergenic
1068613514 10:59086831-59086853 ATGGCTCTGGCTCCTCAGATTGG - Intergenic
1068856013 10:61798188-61798210 ATGGCTGTGGGCCCTGCTGTGGG + Intergenic
1072411908 10:95210670-95210692 TTGGCTTTTGGTCCTCATGTAGG - Exonic
1074466760 10:113690655-113690677 TTGGCTCTGGGTGCTTTTGGCGG + Intronic
1075501100 10:122974786-122974808 ATTGCTCTGGGCCCCATTGTTGG + Intronic
1076368137 10:129935389-129935411 ATGGCACTGGGTCCTTCTGCTGG - Intronic
1077922814 11:6654702-6654724 CTGGGACTGTGTCCTCTTGTGGG + Intronic
1081770130 11:45645161-45645183 ATGGCTGGGGCTCCTCTTGGTGG + Intergenic
1085359093 11:75869905-75869927 ATGGTTTTATGTCCTCTTGTGGG + Intronic
1086798318 11:91136987-91137009 ATGGTACTGGGTCTTCTTTTGGG + Intergenic
1088380832 11:109191032-109191054 ATGAATCTGGGTGCTCCTGTTGG + Intergenic
1089246698 11:117126362-117126384 ATGACTCTGTTCCCTCTTGTGGG - Intergenic
1091015741 11:132049525-132049547 CTGGCTCTGGGGTCTCTTGCAGG + Intronic
1094321557 12:29189490-29189512 AGGACTCTGGCTCCTCTTGTTGG + Intronic
1096529879 12:52235850-52235872 TTGGCTCTGTGTCCTCTCCTAGG - Intronic
1096750077 12:53752927-53752949 ATGGGACTGTGTCCTCTTGGGGG + Intergenic
1099835122 12:87900799-87900821 ATGGGTCTGGGTCCTGTAGTTGG + Intergenic
1102024343 12:109705087-109705109 ATGCCTCAGGGACCTCTAGTTGG - Intergenic
1102774980 12:115510822-115510844 ATGGCTTTGGGTGCACATGTGGG - Intergenic
1104779777 12:131412676-131412698 CTGGCTCTGTGTGCTCTTCTAGG - Intergenic
1106958030 13:34964775-34964797 ATGTCTCTGGGTCCATTAGTAGG + Intronic
1107080211 13:36366805-36366827 ATGGTTCTTGGTCCTCATGCCGG - Intronic
1109378161 13:61524562-61524584 ATGGAGCTGGGTCCTCTGCTGGG + Intergenic
1110539105 13:76687797-76687819 TTGGCTCTGTGTCCTCAGGTGGG - Intergenic
1111863801 13:93742641-93742663 ATGCCTCTGGGTGCTGTTCTTGG + Intronic
1112139019 13:96617755-96617777 ATGGCTCTAGTTGCTCTAGTTGG - Intronic
1114850684 14:26379243-26379265 AAAGCTCTGTGTCCTTTTGTGGG - Intergenic
1117967464 14:61220546-61220568 ATGATTCTTGGTCTTCTTGTTGG - Intronic
1119711408 14:76825130-76825152 AGGGCTCTGGGTGCTCTACTTGG - Intronic
1125520892 15:40347332-40347354 AAGGCTCTGAGTCCTCCTGAAGG - Intergenic
1125600650 15:40913829-40913851 CAGGCCCTGGATCCTCTTGTAGG - Intergenic
1128496504 15:68201344-68201366 CTGGCACTGGGCCCTCTTGCAGG - Intronic
1133809792 16:9152591-9152613 ATGGCTCTGAGTCTTCTGCTCGG + Intergenic
1135431076 16:22383964-22383986 ATGGCCCTGTGTGCTGTTGTTGG + Intronic
1136118476 16:28112006-28112028 ATGCCTTTGGGGTCTCTTGTAGG - Exonic
1138772529 16:59683039-59683061 AAGGCTCTGGGTCCTCTTCCAGG + Intergenic
1139953050 16:70681158-70681180 GAGGCTCTGGGTCCTCTCGGAGG + Intronic
1140734820 16:77888909-77888931 GTGGCTGTGGGTGCTGTTGTTGG - Intronic
1141025539 16:80543292-80543314 ATGACTCTGGATCCTCTTTAAGG - Exonic
1144063894 17:11607320-11607342 ATGGCTCAGTGTCCTCTTCTGGG - Intronic
1144947684 17:18978165-18978187 ATGGCTCAGGGTCCCCCTGGGGG + Exonic
1148131989 17:45267559-45267581 TTGGCTCTGGGGGCTCTGGTGGG + Exonic
1148464379 17:47856274-47856296 ATTACACTGGGTCCTCTTGGGGG - Intergenic
1149680620 17:58504604-58504626 GTGGCTTTGAGTCCTCTTCTAGG - Intronic
1150144916 17:62760749-62760771 ATGGCTTTAGGTCCTGGTGTTGG + Intronic
1151694571 17:75707585-75707607 ATGGCACCTGGTACTCTTGTGGG + Exonic
1153932471 18:9890290-9890312 ATGGCTCTGATTCCTCTTTCTGG - Intergenic
1155179715 18:23333946-23333968 ATGCCTCTGGGTGCTCTGCTAGG + Intronic
1156297295 18:35804154-35804176 AGGACCCTGGGACCTCTTGTTGG + Intergenic
1159406500 18:68009459-68009481 AGAGCTCTGGATCCTCTTATTGG + Intergenic
1161967392 19:7555978-7556000 AGGGCCCTGGGTGCTCTCGTTGG - Intronic
1163194374 19:15704355-15704377 ATGGCTCTGGGTGCTTTCGTGGG - Intergenic
1163569015 19:18069345-18069367 ATGGGTCTGGAACCTCTTGCTGG - Intronic
1164522614 19:28990612-28990634 CTGGCCCTGGCTCCTCCTGTAGG - Intergenic
1165006115 19:32808548-32808570 ATGGCTCTGGGTTATCTAGGTGG - Intronic
1168580251 19:57549581-57549603 ATGACTCTGGCTTCTCTTTTAGG - Intronic
926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG + Intronic
927413931 2:22856988-22857010 ATGGCTCTGGCTCACCCTGTGGG - Intergenic
927413941 2:22857042-22857064 ATGGCTCTGGCTCACCTTGAGGG - Intergenic
927413951 2:22857096-22857118 ATGGCTCTGGCTCACCTTGAGGG - Intergenic
930751878 2:54942544-54942566 AAGGATCAGGGTGCTCTTGTGGG + Intronic
932595118 2:73088694-73088716 ATCGCTGTAGGTCCTCTTATGGG + Exonic
932835268 2:75030318-75030340 ATGGCCCTGGGTCTTCATGGAGG + Intergenic
934683342 2:96302336-96302358 TTTTCTCTGGATCCTCTTGTGGG - Intronic
936438455 2:112529084-112529106 AGGGCACTGGGACCTCTGGTCGG + Exonic
937037407 2:118793480-118793502 AAGCTTCTGGGTCCTCTTTTTGG - Intergenic
943132337 2:183869848-183869870 TTGGCTCTGGGTCTACTTCTTGG - Intergenic
946900583 2:224368054-224368076 GTGGCTCTGGGTCCATTTGTTGG - Intergenic
947065083 2:226215894-226215916 ATGTCTCTGGGACCACTTGTGGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947615682 2:231555372-231555394 GTGGCCCTGGGTCCTCTTCCTGG - Intergenic
947734210 2:232446483-232446505 ATGGCTCTGTGTGCTATTGGGGG - Intergenic
947840365 2:233204036-233204058 ATGGCTCTGGGTCTTTCTTTGGG - Intronic
947987268 2:234459693-234459715 ATGGCTTGGTGCCCTCTTGTAGG + Intergenic
1170601696 20:17846298-17846320 ATGGTTCTGGGGCCTCTGGCAGG + Intergenic
1173060001 20:39651700-39651722 AAGGCTTTGGGTCCTCCTGGAGG + Intergenic
1175431653 20:58909233-58909255 AGGGCTCAGAGTCCTCTGGTGGG - Intronic
1177974499 21:27830048-27830070 GAGGTTCTGGGTCCTCTTTTAGG + Intergenic
1179542119 21:42089913-42089935 GTGGCTCTGGGTTTCCTTGTTGG + Intronic
1180856188 22:19047156-19047178 CTAGCTCTGGGTCCTCTGGTGGG + Intronic
1182041202 22:27240085-27240107 CTGGCTCTGGGGCCTCCTGGGGG + Intergenic
1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG + Intronic
1185071501 22:48659194-48659216 ATGATTCTGGGTCCCTTTGTGGG - Intronic
950638192 3:14330745-14330767 ATGTCTCTGTCTCCTCTTCTAGG - Intergenic
951577901 3:24132253-24132275 ATCTTTCTGGGTCCTCTTGAAGG + Intronic
952902179 3:38117660-38117682 ATGTCTCTGTGTGCCCTTGTGGG + Intronic
953071531 3:39525580-39525602 ATGGCTCTGTGTCCTTGAGTGGG + Intronic
961049524 3:123734657-123734679 ATTCCTGTGGGCCCTCTTGTGGG - Intronic
961906102 3:130264411-130264433 CTGGCTCTGAGACCCCTTGTAGG - Intergenic
967369337 3:188726128-188726150 ATCACTCTGGGTACTATTGTGGG + Intronic
968609248 4:1549643-1549665 AGGCCTCCGGGTCCTGTTGTGGG - Intergenic
969070625 4:4535509-4535531 GTGTCTCTGGGCCCTCTGGTTGG + Intronic
970274394 4:14382240-14382262 ATGGGTCTGGGTGCTCTAGGTGG + Intergenic
974439765 4:61900860-61900882 ATGGCTCTGAGTCAACTTGTTGG - Intronic
975768679 4:77697512-77697534 ATGGGTGTGGGTGCTCTTTTTGG + Intergenic
978145600 4:105367465-105367487 ATGTCTGGTGGTCCTCTTGTGGG - Intergenic
978687020 4:111458038-111458060 ATGAATCTGGGTGCTCCTGTAGG - Intergenic
979242027 4:118455737-118455759 ATGGCTATGGGGCTTCTTTTGGG - Intergenic
979797042 4:124858671-124858693 ATGGCTCTGGGTGCTCTCAAAGG + Intergenic
983257788 4:165421327-165421349 ATAGCTCCTGGTCCTCCTGTGGG + Intronic
984785872 4:183566789-183566811 TTTGCTCTGTGTACTCTTGTGGG - Intergenic
985326882 4:188780881-188780903 ACAGCACTGTGTCCTCTTGTGGG - Intergenic
985720876 5:1488056-1488078 ATGGCTCAGGGTACCCTTCTTGG - Intronic
990003628 5:50922189-50922211 AGGCCTCCGGGTCCTGTTGTGGG + Intergenic
999026818 5:148242831-148242853 ATGACCCTGGTTTCTCTTGTTGG - Intergenic
999674222 5:153982883-153982905 ATGGCTCTGGGGCCTCCTGAAGG - Intergenic
1001271109 5:170312275-170312297 AGGGCCCTGAGTCCTATTGTGGG - Intergenic
1001569879 5:172723565-172723587 ATTGCCCTGGTTCCTTTTGTTGG - Intergenic
1002074707 5:176701276-176701298 CTGGCTCTGAGCCCTCTTGGTGG + Intergenic
1002309344 5:178305412-178305434 TTGGCCCGGGGTCCTCTTGGTGG + Intronic
1002681343 5:180967657-180967679 AGGGCTCTTGATCCACTTGTAGG + Intergenic
1003386197 6:5669778-5669800 AAGGCTCTGGGTGCTCTTGCAGG - Intronic
1004979048 6:21002204-21002226 TTGGATCTGGGTCCTTTCGTTGG + Intronic
1006076527 6:31536357-31536379 ATGGCTCTGGGTTCCCTGGTTGG - Intronic
1006517848 6:34554675-34554697 TTGGCTCTGGCCCCTCTTGCAGG + Intronic
1007403701 6:41619731-41619753 ATGTCTGTGGGTCCTCTTGTTGG + Intergenic
1009461404 6:63918608-63918630 TTGGCTCTGTGTCATCTTCTTGG - Intronic
1009772170 6:68157861-68157883 CTGGCTCTGAGTTCTCTTTTAGG + Intergenic
1013410221 6:109877129-109877151 ATTGCTCTGGGGCCTCTTCATGG + Intergenic
1015452283 6:133384566-133384588 ATGACTCTAGGTCTTCTTGAAGG - Intronic
1016771745 6:147859632-147859654 ATCACCCTGGGTTCTCTTGTTGG - Intergenic
1017871312 6:158488963-158488985 ATGGCTCTGGGTTCTTCTGGGGG - Intronic
1020433586 7:8138178-8138200 ATGGTTCTGGATTCTCTTTTGGG + Intronic
1022429452 7:30301836-30301858 CTGGAGCAGGGTCCTCTTGTAGG + Intronic
1022430181 7:30311151-30311173 CTGGCTCTGGGTCTTGTTTTTGG + Intronic
1023983650 7:45083164-45083186 CTGGCTGTGGGTCATCCTGTTGG + Exonic
1024408203 7:49007275-49007297 ATGAATCTGGGTGCTCCTGTTGG + Intergenic
1029314992 7:99703803-99703825 TAGGCTCTGGCTGCTCTTGTAGG + Intronic
1032013227 7:128360197-128360219 ATGGCTCTGGCTCTTCTTGCCGG + Intronic
1034497500 7:151431410-151431432 AGGACACTGGGTCCTCCTGTTGG - Intronic
1036109360 8:5880208-5880230 TTGGCTCTGTGTGCTCTTTTTGG - Intergenic
1036551420 8:9818030-9818052 AAGGCTCTGGGGACTGTTGTGGG + Intergenic
1036659853 8:10700917-10700939 ATGGCTCTGGGTCCTCTTGTGGG - Intronic
1037044373 8:14278983-14279005 ATGGCTCTGGTTCCTGGTCTAGG + Intronic
1042359760 8:67869154-67869176 ATAGCTCTGATTCCTCATGTTGG + Intergenic
1045878299 8:107008681-107008703 TTGGCTCTGTGGCCTCTTTTTGG - Intergenic
1051050575 9:12927773-12927795 ATGGTTCTGGGTCTTGTTATGGG + Intergenic
1055680956 9:78714826-78714848 AAGGCTCTGGGGAATCTTGTGGG + Intergenic
1056822956 9:89856444-89856466 ATGGCTCCAGGTCGCCTTGTGGG + Intergenic
1059234180 9:112748384-112748406 CTGGGTCTGGGTCCTTTTTTTGG + Intergenic
1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG + Exonic
1061237033 9:129349275-129349297 CTTGCTCTGGGGCCTCTTGGAGG + Intergenic
1062020208 9:134315814-134315836 ATTGCTCTTGGTCCTCTGGAAGG + Intergenic
1203791375 EBV:153532-153554 AGGCATCTGGGTGCTCTTGTAGG + Intergenic
1187239407 X:17499180-17499202 ATGATTCTGGGTCCTATGGTTGG + Intronic
1190926153 X:54907013-54907035 AGGGCTCTGGTTCCTTTTATTGG + Intergenic
1195332654 X:103817260-103817282 ATGAGTTTGTGTCCTCTTGTGGG + Intergenic
1197441770 X:126500239-126500261 ATTGCTCTGAGTCCTCTTGATGG + Intergenic
1199259623 X:145756445-145756467 ATGGCTCTGGCTCCTTTTATTGG + Intergenic
1201348069 Y:13006701-13006723 ATGAATCTGGGTGCTCTTGTTGG - Intergenic
1201353692 Y:13074200-13074222 ATGAATCTGGGTTCTCTTTTTGG - Intergenic
1202389728 Y:24357542-24357564 ATGGCTATGGGGCTTCTTTTGGG - Intergenic
1202481056 Y:25312572-25312594 ATGGCTATGGGGCTTCTTTTGGG + Intergenic