ID: 1036663838

View in Genome Browser
Species Human (GRCh38)
Location 8:10726180-10726202
Sequence TACGGGTGCCCTGGCAGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036663823_1036663838 25 Left 1036663823 8:10726132-10726154 CCCAGGGGGTGGCTACAGTGGAG 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG 0: 1
1: 0
2: 3
3: 28
4: 161
1036663824_1036663838 24 Left 1036663824 8:10726133-10726155 CCAGGGGGTGGCTACAGTGGAGA 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG 0: 1
1: 0
2: 3
3: 28
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036663838 Original CRISPR TACGGGTGCCCTGGCAGGTG GGG Exonic
900309087 1:2024799-2024821 TGTGGGAGCCCTTGCAGGTGGGG - Intronic
900633174 1:3649573-3649595 GGCAGGTGCCCGGGCAGGTGCGG - Intronic
901254285 1:7807825-7807847 TCCAGGTGGCCTGGCAGGTAAGG - Intronic
903028020 1:20443322-20443344 TAAAGGTGCCCAGGCAGATGGGG + Intergenic
905107720 1:35574128-35574150 TATGGGTCCCCTGCCAGGTGGGG - Exonic
905880020 1:41457339-41457361 TCCGGGTGCCCTGGGGGATGGGG + Intergenic
910292629 1:85614298-85614320 TACATATGCCCTCGCAGGTGAGG + Intergenic
913177587 1:116289002-116289024 GATGGGTCCCCTGGAAGGTGAGG + Intergenic
916329400 1:163597109-163597131 TAAGAGTGCCCTGGCTGGGGAGG + Intergenic
919005685 1:191896682-191896704 TACCTGTGCCTTGGCTGGTGAGG + Intergenic
920679897 1:208064381-208064403 TAAGGCTGGCCTGGCAGGTGTGG + Intronic
1071776391 10:88792914-88792936 TGCGGTTTCCCTGGCTGGTGTGG - Intergenic
1073208449 10:101780785-101780807 TCCGGGTGGCCTGGCATATGGGG - Intergenic
1076249900 10:128977528-128977550 TAGGGTTGGCCTGGCAGGTTGGG - Intergenic
1076638950 10:131901139-131901161 GCCGGCTGCCATGGCAGGTGAGG + Exonic
1077109816 11:857243-857265 GACTGGTGCCATGCCAGGTGTGG - Intronic
1077411433 11:2405670-2405692 AGCGGGGGCCCTGGCAGGAGAGG - Intronic
1077889004 11:6405381-6405403 TAGCTGGGCCCTGGCAGGTGAGG - Intronic
1083341591 11:61961908-61961930 CACTGGTGCCCTGGCATGAGTGG - Intronic
1083625249 11:64069038-64069060 TCCGGGGGCAGTGGCAGGTGGGG + Intronic
1083856548 11:65395999-65396021 TCTGTGTGCCCTCGCAGGTGGGG + Intronic
1083880037 11:65543826-65543848 AAAGGGAGCCATGGCAGGTGAGG - Intronic
1084041121 11:66543311-66543333 TAGGGGAGGCCTGGCTGGTGGGG - Intronic
1084460843 11:69295786-69295808 CAAGGGTGCCCAGACAGGTGCGG + Exonic
1084646829 11:70463774-70463796 TGTGGATGCGCTGGCAGGTGTGG + Intergenic
1084891012 11:72237249-72237271 GACAGGGGCCCTGGCAGGCGAGG - Exonic
1086501977 11:87463029-87463051 TAAGGGTGCCCTGGCTGACGAGG + Intergenic
1086837318 11:91640913-91640935 TACGGGGGCCCTGTACGGTGGGG - Intergenic
1087895146 11:103578335-103578357 CACATGTGCCCTTGCAGGTGTGG + Intergenic
1089343152 11:117773226-117773248 TGCAGGTGCCCTGGGAGGAGGGG - Intronic
1089833870 11:121352852-121352874 TTCGGGTTGCCTGTCAGGTGAGG - Intergenic
1089979440 11:122760218-122760240 TAAGGGTGCCCAGACAGGTAGGG + Intronic
1090400053 11:126443273-126443295 TCCGAGTGCCCTGGCTGGCGCGG + Intronic
1091187254 11:133657963-133657985 TAAGGCTGCCTTGACAGGTGGGG + Intergenic
1091617034 12:2057508-2057530 TACCTGTGCCGGGGCAGGTGTGG - Intronic
1091818501 12:3456964-3456986 TACAGTTGCCATGGCAGGCGAGG - Intronic
1092118857 12:6029618-6029640 CAGGGGTGCAGTGGCAGGTGGGG - Intronic
1103168282 12:118789935-118789957 TAAGGGTGCCCTGGCTTCTGGGG - Intergenic
1103500797 12:121400259-121400281 TTCAGGTGCCCTGGCAGGATAGG - Intronic
1104589293 12:130071285-130071307 TAATGGGGCCCTGCCAGGTGTGG - Intergenic
1104919849 12:132285091-132285113 TCAGGGTTCCCTGGCGGGTGGGG + Intronic
1105702052 13:22941096-22941118 TCCAGGTGGCCTGGCAGGCGAGG - Intergenic
1105854676 13:24362881-24362903 TCCGGGTGGCCTGGCAGGCAAGG - Intergenic
1106241632 13:27918001-27918023 TAGGGGTGCCCAGGGAGGAGGGG + Intergenic
1111718360 13:91910239-91910261 TACACGTGCCCTGGCAGGGATGG + Intronic
1112901635 13:104364086-104364108 GACTGGTGTCCTTGCAGGTGAGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1118884795 14:69857630-69857652 TGCTTGAGCCCTGGCAGGTGAGG - Intronic
1120954413 14:90068796-90068818 AACTGGTGGCCAGGCAGGTGTGG + Intronic
1122843529 14:104478103-104478125 TCCGGGTGGCCTGGCAGGCGAGG - Intronic
1123739099 15:23217779-23217801 TACGCGTGCCCTGGCAGGGATGG + Intergenic
1124290317 15:28446735-28446757 TACGCGTGCCCTGGCAGGGATGG + Intergenic
1124292920 15:28470813-28470835 TACGCGTGCCCTGGCAGGGATGG - Intergenic
1125506935 15:40272484-40272506 CAAGGGTGCCCTGGCTGGTGAGG + Exonic
1127393976 15:58528908-58528930 CCTGGGTGCCCTGGCAGGTAGGG - Intronic
1129329401 15:74819256-74819278 CACCGGCACCCTGGCAGGTGAGG + Exonic
1132956901 16:2599150-2599172 TCCTGGTGGCCTGGCAGGTCTGG + Exonic
1133473962 16:6101838-6101860 TACAGCTGCCCCGGCAGATGAGG - Intronic
1136708418 16:32210875-32210897 TACGCGTGCCCTGGCAGGGATGG - Intergenic
1136759485 16:32718534-32718556 TACGCGTGCCCTGGCAGGGATGG + Intergenic
1136808619 16:33151852-33151874 TACGCGTGCCCTGGCAGGGATGG - Intergenic
1137589893 16:49687063-49687085 TAGGGGTGCTCTGCCAGATGTGG - Intronic
1139360469 16:66396210-66396232 TCCAGGTGCCCTGGCAGATGTGG - Intronic
1141149099 16:81551971-81551993 CAGGGGGGCCCTGGCTGGTGGGG + Intronic
1141205862 16:81932733-81932755 CATGGGTGCCCTCGCTGGTGGGG + Intronic
1141786176 16:86202258-86202280 TAAGGGTGCCCTGCCAGGGTGGG + Intergenic
1141932607 16:87216099-87216121 TAAGGGTCACCTGGGAGGTGAGG + Intronic
1203061640 16_KI270728v1_random:978842-978864 TACGCGTGCCCTGGCAGGGATGG + Intergenic
1143476260 17:7205349-7205371 TTCGGTTGCCCTGGCAATTGGGG - Intronic
1143543453 17:7582870-7582892 TGCTGGGGCCCTGCCAGGTGAGG - Intergenic
1144737844 17:17564832-17564854 TAGGGGTGCCCTGGCCAGGGAGG + Intronic
1144809041 17:17986879-17986901 TCAGGGTTACCTGGCAGGTGGGG - Intronic
1144825357 17:18102706-18102728 TCCTGGTGCTCTGGAAGGTGTGG + Intronic
1144875444 17:18394842-18394864 TACTGGGGCCCTGGCATGGGGGG - Intergenic
1145156781 17:20549579-20549601 TACTGGGGCCCTGGCATGGGGGG + Intergenic
1145796847 17:27660564-27660586 TCCAGGTGCCCTGTCTGGTGGGG + Intergenic
1146692045 17:34883398-34883420 TGGGGGTCCCCTGTCAGGTGGGG - Intergenic
1147892916 17:43729945-43729967 CACGAGTGTCCTGGCATGTGGGG - Intergenic
1148029878 17:44612218-44612240 CACTGATGCCCTGACAGGTGAGG - Intergenic
1148107789 17:45128487-45128509 TGTGGGTGACTTGGCAGGTGAGG - Intronic
1151353515 17:73545329-73545351 TTCGGGTCCCATGGCAGGAGGGG + Intronic
1152072734 17:78142006-78142028 GGCGGGGGCCCAGGCAGGTGAGG + Exonic
1153537279 18:6115870-6115892 TACAGATGCCCTGGGAGGTGGGG + Intronic
1153952524 18:10069232-10069254 TACAGGAGCACTGGCAGGTGAGG - Intergenic
1157927308 18:51780417-51780439 TGCTGGTGCCCTGGCAGCCGCGG - Intergenic
1158064764 18:53393341-53393363 TACTGCTGCCCTGTTAGGTGAGG + Intronic
1160583767 18:79901683-79901705 TGCAGGGGCCGTGGCAGGTGGGG - Intergenic
1160585889 18:79913164-79913186 GATGGGTGACCAGGCAGGTGTGG - Intronic
1160725022 19:614042-614064 GGCGGGTGCCCTGGCGGGGGAGG + Intronic
1161222547 19:3124306-3124328 CACAGGTGCCCTGGAAGGTGAGG - Intergenic
1161273191 19:3401524-3401546 TGCATGTGCCCAGGCAGGTGCGG - Intronic
1163023602 19:14496481-14496503 CTCGGGTGCCCTGGGTGGTGAGG + Intergenic
1163290788 19:16377817-16377839 TGCGGGTGGCCGGGCATGTGAGG - Intronic
1163392678 19:17039762-17039784 TATTGGAGCCCTGGCAGGTGAGG - Intergenic
1165091059 19:33388663-33388685 TGCGCGTGGCTTGGCAGGTGTGG + Intronic
1165432028 19:35778344-35778366 TGCAGGTGACCTGTCAGGTGAGG + Exonic
1167994784 19:53393635-53393657 TACAGGTGCCCTCTCTGGTGAGG - Intronic
925081168 2:1068220-1068242 TACGGGCGCCCTGCTATGTGAGG - Intronic
929961229 2:46497793-46497815 TGAGCGTGCCCTGGCTGGTGAGG + Intronic
931504068 2:62904617-62904639 AACAGGAGCCCTGCCAGGTGTGG + Intronic
934996636 2:98967567-98967589 CACAGGTGCACTGGCAGGTAAGG + Intergenic
936618528 2:114072425-114072447 AAAGGGTGGTCTGGCAGGTGAGG + Intergenic
938079417 2:128361742-128361764 TGAGGGTACCCTGGGAGGTGAGG + Intergenic
945765235 2:213968346-213968368 TACAGGTGTGGTGGCAGGTGTGG - Intronic
946034756 2:216732736-216732758 TGCTGGTGAACTGGCAGGTGGGG - Intergenic
946125680 2:217560564-217560586 TAAGGGTGCCCTGGCTGATGAGG - Intronic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
1169018400 20:2310298-2310320 TATGGGTGCGCTGGCAGGACTGG - Exonic
1171426277 20:25050703-25050725 TCCTGGTGCCCTGGCTGCTGTGG - Intronic
1172842890 20:37912649-37912671 CACTGGTGCCCTTGGAGGTGAGG + Intronic
1172958802 20:38782398-38782420 ATAGGGAGCCCTGGCAGGTGTGG - Intergenic
1173626385 20:44476011-44476033 TCCGTGTGCCCTGGGAGCTGAGG + Intronic
1173647221 20:44640987-44641009 AACGTGTGCCCTGGCAGTTCTGG - Intronic
1174134336 20:48368654-48368676 AACGGGTGCCCTGGGAGGCACGG - Intergenic
1174466617 20:50722730-50722752 TACAGGTTCCCTGCTAGGTGTGG + Intergenic
1175855185 20:62117294-62117316 CACGGGTGCGCTGCCTGGTGAGG + Intergenic
1175979030 20:62727840-62727862 TATGGGTGCCATGGCAAGGGTGG + Intronic
1176091948 20:63322119-63322141 TTGGGGAGCCCTGGGAGGTGAGG + Intronic
1178843747 21:36157343-36157365 TGCTGGTGCCCTGGCTGGGGAGG + Intronic
1179913079 21:44460467-44460489 CACTGGTGGCCTGGCTGGTGTGG - Exonic
1179957413 21:44749339-44749361 TGCGGCTGCCCAGGCAGGTCGGG + Intergenic
1181688863 22:24547120-24547142 ACCGTCTGCCCTGGCAGGTGGGG - Intronic
1182411585 22:30191414-30191436 TATGAGTGCTGTGGCAGGTGGGG + Intergenic
1183583582 22:38739538-38739560 TGCTGGTGCCCAGGCAGATGTGG + Intronic
1184472624 22:44704326-44704348 TGCGGGTCCCCAGACAGGTGGGG + Intronic
949942037 3:9162622-9162644 AAAGGATGACCTGGCAGGTGGGG + Intronic
950713389 3:14829817-14829839 TGGGGGTGCACTGACAGGTGGGG - Intronic
951309264 3:21104367-21104389 TACGGGTGTCATTGCATGTGAGG + Intergenic
967622000 3:191644500-191644522 TATGGGTGTCCTTGCATGTGAGG - Intergenic
968550803 4:1222614-1222636 GGCGGGGGCCCTGGCAGGTGGGG + Intronic
968704702 4:2072535-2072557 CACAGAGGCCCTGGCAGGTGGGG - Intronic
968875866 4:3267679-3267701 AAGGGGTGCCCTGGAAGGTGAGG - Intronic
969136763 4:5035546-5035568 AAGTGCTGCCCTGGCAGGTGAGG + Intergenic
969863231 4:10054009-10054031 TACAGGGGCCCTGGCTGATGTGG - Intronic
970959541 4:21856632-21856654 TAGGTGTGCCCGGGAAGGTGGGG - Intronic
985542544 5:493620-493642 TGCTGGTGGCCGGGCAGGTGCGG - Intronic
985897051 5:2754960-2754982 TAGGTGTGCCCTAGGAGGTGGGG + Intronic
986172294 5:5324755-5324777 GAAGGGTGGCGTGGCAGGTGAGG + Intergenic
987963241 5:24837788-24837810 TACGGTGGCCATGGCAGTTGTGG + Intergenic
997359544 5:133285958-133285980 TATTGGTGCCCTGGCAGGTGGGG - Intronic
998785351 5:145702790-145702812 TAGGGGTGCCCTGGTAGGTAGGG - Intronic
1000343350 5:160294535-160294557 TGTGGATGCCCTGGCAGCTGTGG - Intronic
1001242173 5:170079310-170079332 TACTCGTGCCCAGGCAGCTGGGG + Intronic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1003047257 6:2745026-2745048 TAGGGGTGAACAGGCAGGTGGGG + Intronic
1006865794 6:37208126-37208148 GTGGGGAGCCCTGGCAGGTGAGG + Intergenic
1008076033 6:47147089-47147111 GTCTGGGGCCCTGGCAGGTGAGG - Intergenic
1013429681 6:110044263-110044285 TCCTGGTGCCCGGGCAGGGGCGG + Intergenic
1014113199 6:117644569-117644591 TACTGTTGCCCTGACAGTTGTGG + Intergenic
1018428349 6:163703244-163703266 TACGCATGCCCTTGCAGCTGTGG + Intergenic
1018430011 6:163714677-163714699 GAGGGGTGCCCTGGCAGGTGGGG - Intergenic
1018807534 6:167272966-167272988 TAAGAGTGCCCTGGCAGAGGAGG + Intronic
1019165820 6:170097046-170097068 TAAGGAGGCCCTGCCAGGTGGGG - Intergenic
1019641918 7:2107857-2107879 CATGGGTGCCCTTGCAGGTCTGG - Intronic
1019722637 7:2582495-2582517 TGCCGGTGCTCTGGCAGGAGGGG + Intronic
1019746865 7:2705676-2705698 TAGGGGTCCCCTGGCTGGGGTGG + Intronic
1022567793 7:31420883-31420905 TAGGGGGGACCTGGCAGGTAGGG - Intergenic
1023027974 7:36068976-36068998 TGAGGGTGCCTTGTCAGGTGAGG - Intergenic
1023192299 7:37595662-37595684 TAGGGGTGCCCTGGCATGTAGGG + Intergenic
1024398383 7:48894712-48894734 TAAGGGTCCCCTGGCAGAAGGGG - Intergenic
1025713532 7:63932310-63932332 CACGGGCACCCTGGGAGGTGGGG - Intergenic
1028456252 7:91041064-91041086 TGCCTCTGCCCTGGCAGGTGTGG - Intronic
1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG + Exonic
1037920738 8:22803750-22803772 TACTGGAGGCCTGGCAGGTGAGG - Intronic
1039473450 8:37827353-37827375 GGGGGCTGCCCTGGCAGGTGTGG + Intronic
1039943822 8:42113487-42113509 GATGGTAGCCCTGGCAGGTGAGG - Intergenic
1045368218 8:101495061-101495083 TAAGGGAGCCCCGGCAGGGGTGG + Intronic
1045546057 8:103129657-103129679 TACGTGTGCTCTGGCAGGTGAGG + Intergenic
1045557743 8:103231035-103231057 TTCAGGTACCCTGGGAGGTGGGG - Intergenic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG + Exonic
1053137244 9:35658746-35658768 TAGGGGTGCCCCTGCAGGTGCGG + Intronic
1053594196 9:39543613-39543635 TTAGGGTGCCCTGGCAGAGGAGG - Intergenic
1053799596 9:41755865-41755887 TAAGAGTGCCCTGGCAGAGGAGG - Intergenic
1053851976 9:42298659-42298681 TTAGGGTGCCCTGGCAGAGGAGG - Intergenic
1054188005 9:61967925-61967947 TAAGAGTGCCCTGGCAGAGGAGG - Intergenic
1054465363 9:65490237-65490259 TAAGAGTGCCCTGGCAGAGGAGG + Intergenic
1054572057 9:66821344-66821366 TTAGGGTGCCCTGGCAGAGGAGG + Intergenic
1054650510 9:67620656-67620678 TAAGAGTGCCCTGGCAGAGGAGG + Intergenic
1056398275 9:86201855-86201877 TATTTGTGCCTTGGCAGGTGGGG + Intergenic
1060733691 9:126053017-126053039 CAGGGGAGCCCGGGCAGGTGGGG - Intergenic
1060813752 9:126624252-126624274 TCGGGGTGCCCCGCCAGGTGGGG + Intronic
1061273633 9:129557731-129557753 TGGGGTTGCCCTGGCAGGGGCGG - Intergenic
1061368803 9:130186571-130186593 TTCGGGAGCCCTGGAAGGTGAGG - Intronic
1061612953 9:131760613-131760635 TAAGGGTGCCTTGGTGGGTGGGG - Intergenic
1186509203 X:10117660-10117682 CACGGGAGCGCTGGCTGGTGGGG - Exonic
1186579202 X:10799146-10799168 CACTGGTGGCCTGCCAGGTGAGG - Intronic
1189281102 X:39820720-39820742 TACCTGTGCCCGCGCAGGTGAGG + Intergenic
1191059709 X:56281697-56281719 TAAGTGTGACATGGCAGGTGCGG - Intronic
1193519066 X:82506801-82506823 CACGGGTGCCATGGCAGTAGCGG + Intergenic
1199976092 X:152895757-152895779 TAGAGGTGCCCTGGCAGGCGTGG + Intergenic
1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG + Intergenic
1200143257 X:153912665-153912687 TACAGGTGGGCTGGCATGTGGGG + Intronic