ID: 1036664548

View in Genome Browser
Species Human (GRCh38)
Location 8:10730309-10730331
Sequence TCGGAGCCCTTGTCCCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036664534_1036664548 24 Left 1036664534 8:10730262-10730284 CCTTGGCCCAAACCATGAAGGCG 0: 1
1: 1
2: 1
3: 11
4: 101
Right 1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1036664544_1036664548 -10 Left 1036664544 8:10730296-10730318 CCGGATACGGCTCTCGGAGCCCT 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1036664543_1036664548 -7 Left 1036664543 8:10730293-10730315 CCGCCGGATACGGCTCTCGGAGC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1036664539_1036664548 12 Left 1036664539 8:10730274-10730296 CCATGAAGGCGTTCATGGGCCGC No data
Right 1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1036664535_1036664548 18 Left 1036664535 8:10730268-10730290 CCCAAACCATGAAGGCGTTCATG 0: 1
1: 4
2: 3
3: 9
4: 77
Right 1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1036664536_1036664548 17 Left 1036664536 8:10730269-10730291 CCAAACCATGAAGGCGTTCATGG 0: 1
1: 9
2: 4
3: 10
4: 73
Right 1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036664548 Original CRISPR TCGGAGCCCTTGTCCCCCGG GGG Intronic