ID: 1036665015

View in Genome Browser
Species Human (GRCh38)
Location 8:10732309-10732331
Sequence GTTCCAGGATGCTGCCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036665015_1036665020 -5 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665020 8:10732327-10732349 GGAACCAGAGGCGAAGCGGCGGG No data
1036665015_1036665021 -4 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665021 8:10732328-10732350 GAACCAGAGGCGAAGCGGCGGGG No data
1036665015_1036665024 7 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665024 8:10732339-10732361 GAAGCGGCGGGGGACCCACCTGG No data
1036665015_1036665025 8 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665025 8:10732340-10732362 AAGCGGCGGGGGACCCACCTGGG No data
1036665015_1036665026 9 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665026 8:10732341-10732363 AGCGGCGGGGGACCCACCTGGGG No data
1036665015_1036665017 -9 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665017 8:10732323-10732345 TCCTGGAACCAGAGGCGAAGCGG No data
1036665015_1036665019 -6 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665019 8:10732326-10732348 TGGAACCAGAGGCGAAGCGGCGG No data
1036665015_1036665022 -3 Left 1036665015 8:10732309-10732331 CCGCTGGGGCAGCATCCTGGAAC No data
Right 1036665022 8:10732329-10732351 AACCAGAGGCGAAGCGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036665015 Original CRISPR GTTCCAGGATGCTGCCCCAG CGG (reversed) Intronic