ID: 1036665892

View in Genome Browser
Species Human (GRCh38)
Location 8:10738110-10738132
Sequence CCTTCTCCAGACAATGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036665892_1036665904 24 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665904 8:10738157-10738179 GGGAACTAAAACAGAAACCAGGG No data
1036665892_1036665903 23 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665903 8:10738156-10738178 GGGGAACTAAAACAGAAACCAGG No data
1036665892_1036665898 2 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665898 8:10738135-10738157 TCCAGGCCATGATGCAGGGAAGG No data
1036665892_1036665900 3 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665900 8:10738136-10738158 CCAGGCCATGATGCAGGGAAGGG No data
1036665892_1036665897 -2 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665897 8:10738131-10738153 GGTCTCCAGGCCATGATGCAGGG No data
1036665892_1036665896 -3 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665896 8:10738130-10738152 AGGTCTCCAGGCCATGATGCAGG No data
1036665892_1036665901 4 Left 1036665892 8:10738110-10738132 CCCTGATCATTGTCTGGAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1036665901 8:10738137-10738159 CAGGCCATGATGCAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036665892 Original CRISPR CCTTCTCCAGACAATGATCA GGG (reversed) Intronic
903286176 1:22278107-22278129 CCTTCTCCCGAAAATGGCCACGG - Intergenic
909399574 1:75212010-75212032 CCTTCTCAACACAGTGATCCAGG + Intronic
910318749 1:85919768-85919790 CCTTCACCAGACAATTAACATGG + Intronic
913481880 1:119296468-119296490 CCATCTCCAAAAAATTATCAGGG - Intergenic
915252541 1:154600866-154600888 CTTTCTCCAGATATTGAGCAGGG - Intronic
916731056 1:167567137-167567159 CCCTCTCCAGACAGAGGTCAAGG + Intergenic
917642812 1:176999213-176999235 CCTTCTCCAGAGAAAGAGGATGG + Intronic
917813547 1:178684564-178684586 CCTTATTCAGAGAATGATGAGGG + Intergenic
918045686 1:180939648-180939670 CCTTCTCCACACAATAGTCAAGG + Intronic
919270389 1:195335391-195335413 CCTTCTTCAGACTATCTTCAAGG + Intergenic
919658662 1:200221936-200221958 CCTTGTCCAGGCAAGGATCTCGG + Intergenic
919763593 1:201112824-201112846 CCTTCTCCAGACAATGTCATGGG - Intergenic
920579102 1:207088257-207088279 CCTTCTCCAGAGAAATTTCATGG - Intronic
920732798 1:208503722-208503744 CCTTCTCTTTACAATGACCATGG + Intergenic
921382684 1:214541313-214541335 CCTTCTCCAAACATTTCTCAGGG - Intronic
921908232 1:220518268-220518290 CATTCTGCAGCCCATGATCAAGG + Intergenic
921931075 1:220754807-220754829 CATTTTCCAGACAATTATCCAGG - Intronic
923273896 1:232380205-232380227 CCTTATCCAGAAAGTGATCTTGG + Intergenic
923326422 1:232884230-232884252 CCTTCTCCACATGATGATCCAGG + Intergenic
1062995823 10:1865665-1865687 CCTTCACCAGTGAGTGATCATGG + Intergenic
1066339642 10:34518365-34518387 CATTCTCCAGTTAATGAACAAGG + Intronic
1068718163 10:60211250-60211272 CCTTCTCCAGACACTAATTCTGG - Intronic
1069241450 10:66145276-66145298 CCTTCTCCACACAAAGACAAAGG + Intronic
1073883482 10:108009756-108009778 CCATCTCCAGAAAGTTATCATGG + Intergenic
1074816805 10:117148265-117148287 CCATCTCCCTACAATGAGCAAGG + Intergenic
1076228328 10:128799092-128799114 CCTTCCCTTGACAATGATCTTGG + Intergenic
1080108758 11:28541622-28541644 TGTTCTCCACACAATAATCAGGG - Intergenic
1080771893 11:35349410-35349432 CCTTGTCCAGCCAATGCCCAGGG + Intronic
1081691610 11:45082050-45082072 GCTTCTCAAGACACTGCTCAGGG - Intergenic
1083179752 11:60977497-60977519 CCTTCTCCAGACTCAGAGCATGG + Intronic
1086842506 11:91705057-91705079 CCTTCTCAATACAATGCTCCAGG - Intergenic
1087159884 11:94938281-94938303 TCTTCTCCAGACACAGTTCAAGG - Intergenic
1087871101 11:103294271-103294293 CAATGTCCAGACAATGATGAAGG - Intronic
1088558561 11:111088595-111088617 CCTTCTCCAGAAATTAATCCAGG + Intergenic
1089655418 11:119943668-119943690 CCCTCTCCAGGCCATGATGAAGG + Intergenic
1090311273 11:125743218-125743240 CTTTCTCCAGACAATAAAAATGG - Intergenic
1090708619 11:129364188-129364210 CCTTCCCAAGACAATGTTCTGGG + Intergenic
1094072468 12:26432998-26433020 CCTTCTCCAGACAATTCTGATGG + Intronic
1095780054 12:46049202-46049224 CCTTTCCCAGACATAGATCATGG + Intergenic
1098436976 12:70478086-70478108 ACTTTTCCAGTCCATGATCATGG + Intergenic
1103118157 12:118355682-118355704 GCTTCACCAGAAAGTGATCATGG - Intronic
1104898773 12:132176694-132176716 CCATCTCCAGAGCATCATCAGGG - Intergenic
1105051138 12:133052213-133052235 CCCTCCCCAGAAAAAGATCATGG - Intronic
1106469781 13:30044103-30044125 CCTCCTGCAGACCTTGATCATGG + Intergenic
1109260527 13:60139989-60140011 CCTTCTCCAGACAATGAAAAAGG - Intronic
1109359604 13:61279085-61279107 ACTTCTCTATACAATGATCCAGG + Intergenic
1112175325 13:97017430-97017452 CCTTCTCCAGATAATCATTCAGG + Intergenic
1113447226 13:110378842-110378864 CCTTCTCCACAATGTGATCATGG + Intronic
1115234570 14:31196368-31196390 CCTTCTCCAGTAAAGGGTCAGGG + Intronic
1116658725 14:47681076-47681098 CCTTGTCCTGACAATGAGGAAGG + Intergenic
1120392612 14:83928009-83928031 ACTGTCCCAGACAATGATCAAGG + Intergenic
1123859221 15:24446416-24446438 GCTTTTTCAGACCATGATCATGG + Intergenic
1126751185 15:51878136-51878158 CTTTCTCCAGACAATAAGCTAGG + Intronic
1129126365 15:73444855-73444877 CATTCTGCAGCCCATGATCAAGG - Intronic
1129814739 15:78541344-78541366 CCTTCTCCAGAGAGTGATCTGGG - Intronic
1130568669 15:85021184-85021206 CCCTCACCAGACACTGATCTTGG + Intronic
1131040242 15:89257864-89257886 CATTCTCCACACAAGGAGCAAGG + Intronic
1141627343 16:85268313-85268335 CCTCCTCCTGATAATGATAATGG + Intergenic
1203143282 16_KI270728v1_random:1783116-1783138 GCTTCTCCAGGCAGTGAACATGG + Intergenic
1142585810 17:972601-972623 CTTTTTCCTGACAGTGATCAGGG - Intronic
1143265069 17:5630511-5630533 CCTTTACCAGATATTGATCATGG - Intergenic
1143682915 17:8491030-8491052 CTTTGTCCAGAGAAAGATCAAGG - Intronic
1146414609 17:32620363-32620385 CCTTCTCCAGAAAAGCACCAGGG - Intronic
1151388349 17:73769176-73769198 TCTTCTCCAGATACTGATGAAGG + Intergenic
1153386486 18:4503530-4503552 CCTTTCCCAGACAATGACTAAGG + Intergenic
1157806484 18:50661718-50661740 CCATCTCCAGATAAGGACCACGG + Intronic
1158029376 18:52944529-52944551 CCTTCTCCTGTCACTTATCAGGG - Intronic
1160484130 18:79272794-79272816 CCTAATCCACACAATGACCATGG + Intronic
1162669248 19:12240680-12240702 CTTTCTCCATTGAATGATCATGG - Intronic
1164478642 19:28594490-28594512 TCTTCTCCAGGAATTGATCAGGG + Intergenic
1164564271 19:29314792-29314814 CCTCCTCCTGCCAATGACCAAGG + Intergenic
925156495 2:1652315-1652337 TCTTCTCCAGAGAATGAAGAGGG - Intronic
926561463 2:14422145-14422167 CCTTGTCCAGACATTGATAATGG + Intergenic
927490556 2:23518439-23518461 CCTTCTCCAGGAGATGCTCACGG + Intronic
928412861 2:31067790-31067812 CATTTTCCAGACAAGGATTAAGG + Intronic
929792397 2:45033168-45033190 CTTTCTGTAGACAATCATCAAGG + Intergenic
934607856 2:95711392-95711414 CAGGCTCCAGACAATGTTCAAGG + Intergenic
934869808 2:97853136-97853158 CATTCTTCAGCCAAGGATCAAGG + Intronic
935725638 2:106021617-106021639 CCTTCTCCAGATAAAGAACGAGG + Intergenic
936743192 2:115540128-115540150 CCTTGGCCAGAAAATGACCAAGG + Intronic
936832384 2:116663517-116663539 CCTTTTACTGACAATGATAATGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946153639 2:217792785-217792807 CCCTCTACAAACATTGATCAAGG + Intergenic
946920804 2:224580357-224580379 ACTTCTACAGACAATGATGAAGG + Intronic
1169234952 20:3923289-3923311 CCCTCCCCAGGTAATGATCACGG - Exonic
1172407148 20:34698333-34698355 CCTTCTCACCACAATGGTCAAGG + Intronic
1173329641 20:42063712-42063734 ACCTCTCCAGACAATCATGAGGG - Intergenic
1174940060 20:54917056-54917078 CCTTCTGCAGACAAGAAGCATGG + Intergenic
1182045381 22:27270210-27270232 CCATCTCCTGTCAATGCTCATGG + Intergenic
961173422 3:124815329-124815351 CCTTCACCAGCCAATGCTCTTGG + Intronic
962144350 3:132824416-132824438 CCTCCTCAAGACATTGATTATGG - Intergenic
962249369 3:133826035-133826057 CCTGCTCAAGACAAAAATCAGGG + Exonic
962490062 3:135884489-135884511 CCTTTTCCAGAGAGTGAGCAGGG + Intergenic
966080189 3:175990495-175990517 CCTCCTCCAGGTAATGATCTTGG + Intergenic
967536075 3:190604733-190604755 ATTTCTCCAGACATTGAACAGGG + Intronic
969625376 4:8302279-8302301 CCCTCTCCTGACCATCATCATGG - Intronic
970385952 4:15556746-15556768 CCTTCTTGAGACAATGCACAGGG + Intronic
972007574 4:34130312-34130334 CTTTCTCCAGACAAATATCCTGG - Intergenic
974542431 4:63255221-63255243 CCTCCTCTATACAATCATCATGG + Intergenic
975433630 4:74324228-74324250 CCTTCACAAGAAAATGTTCAAGG - Intergenic
977788119 4:101064299-101064321 CCTTTACCAGTCACTGATCATGG + Intronic
978103889 4:104877287-104877309 CCCTCATCAGACACTGATCAGGG + Intergenic
978966175 4:114744617-114744639 CCTTCTCCAGTGTATGATCCTGG - Intergenic
982637175 4:157911432-157911454 CCTTCTCCAGAGAAAAATGAAGG - Intergenic
982749054 4:159137265-159137287 CCTTCACCAGAAAATGATACAGG - Intronic
983542692 4:168930233-168930255 CCTTCTCAAAATAATGTTCATGG - Intronic
989159340 5:38375434-38375456 CCTTCACAACACAATGTTCAAGG + Intronic
989214377 5:38888837-38888859 CCTTCTTCAGAAAATGTTTATGG + Intronic
989214649 5:38891957-38891979 CCTTCTCCGGGCAAGGCTCATGG + Intronic
989312066 5:40031237-40031259 CCTTCTCTAGAAAATGAATATGG - Intergenic
992763700 5:79974857-79974879 CCTTCTCCAAACTAGGATCTGGG + Intergenic
994198323 5:96943930-96943952 TCTTCTCCAGCCAATGATCTGGG + Intronic
998010962 5:138695277-138695299 CCTTCTTCAGACTCTGATTAGGG + Intronic
1000231488 5:159319568-159319590 ACTGCTCCACACAAAGATCACGG + Intronic
1003065275 6:2899687-2899709 CCTTCTTCACACAATGAGCTGGG + Intronic
1004851913 6:19708101-19708123 CCTACTTCAGAAAATGATCTAGG - Intergenic
1010372257 6:75124013-75124035 CTTTCACCAGACACTGATTATGG - Exonic
1019216547 6:170447510-170447532 CCTTCGCCATACCATGAACATGG - Intergenic
1021165603 7:17336782-17336804 CCTTCTAGAAACATTGATCAAGG - Intronic
1022473488 7:30695518-30695540 CCTACTCCAGTCAGTGTTCAGGG - Intronic
1022636868 7:32144444-32144466 CCATCTCCAGGCAATCATCATGG + Intronic
1023520914 7:41049258-41049280 CCCTCTCCATACCCTGATCAGGG - Intergenic
1024488599 7:49949175-49949197 CCCTCTCCAGAAACTGATCTTGG + Intronic
1026743648 7:72994693-72994715 CCTTCTCCTGACAATTATGATGG + Intergenic
1026783731 7:73286165-73286187 CCTTCTCCTGACAATTATGATGG + Intergenic
1026803562 7:73415358-73415380 CCTTCTCCTGACAATTATGATGG + Intergenic
1027029754 7:74879391-74879413 CCTTCTCCTGACAATTATGATGG + Intergenic
1027100087 7:75370384-75370406 CCTTCTCCTGACAATTATGATGG - Intergenic
1035556358 8:569970-569992 CCTTCCCCAGACTGTGATGAGGG - Intergenic
1036665892 8:10738110-10738132 CCTTCTCCAGACAATGATCAGGG - Intronic
1040890805 8:52314228-52314250 CCTGCTCCAGAAAGTGGTCATGG + Intronic
1043177012 8:77034177-77034199 CCTTCTCCATACAATTAGAAAGG - Intergenic
1044400113 8:91760452-91760474 CCTTCTCTAGAGGATGCTCAGGG - Intergenic
1044607757 8:94061958-94061980 CCTTCTCCAGAAAATTTTCTTGG - Intergenic
1045470610 8:102509014-102509036 CCTTCTCTACACAATCATCATGG - Intergenic
1046945748 8:119972872-119972894 CTTCCTCCAAACAATGACCAGGG + Intronic
1046994013 8:120495370-120495392 CCTTCTAGAGACAATGATTCTGG - Intronic
1048207514 8:132427096-132427118 CCTTCTCAAGACAGTGCTTAGGG - Intronic
1049004870 8:139848095-139848117 CCTTCTCCCTACAATGCTTATGG - Intronic
1049555196 8:143278108-143278130 CCCTCTCCAGACCATGCTCTGGG + Intergenic
1055664216 9:78537291-78537313 CCATCTTCAGACAAGGATCATGG + Intergenic
1056291026 9:85144008-85144030 CCTTGTGCAGACAAGGCTCAGGG - Intergenic
1057281658 9:93716999-93717021 CCTACTCCAGCCAAAGATGAAGG - Intergenic
1057421400 9:94915880-94915902 CTTTTTCCAGACAAGGAACATGG + Intronic
1058755812 9:108082263-108082285 CCTTCTTCAGATAATTGTCAAGG - Intergenic
1059375801 9:113880455-113880477 CCTTCTCAACACAGTGATCCAGG - Intronic
1060787277 9:126460613-126460635 CCTTCTCCAGACCCCGGTCAGGG - Intronic
1185800921 X:3009968-3009990 AATTCTCAATACAATGATCAAGG - Intronic
1186776118 X:12866325-12866347 ACTTCTGCAGATAATGATCAGGG - Intergenic
1187269753 X:17769040-17769062 CCTCATCCAGACCATGAGCAAGG - Intergenic
1188166123 X:26866531-26866553 CCTTCTCCATAGCATAATCAGGG + Intergenic
1194445304 X:93980924-93980946 CCTTCACCAGACACCGATGATGG - Intergenic
1197683708 X:129415712-129415734 CCATCTCCAGAAAATCAGCATGG + Intergenic
1197803182 X:130373413-130373435 CATTCTCCAGAGAATAATAAAGG + Intergenic
1198726002 X:139677585-139677607 CCTTCTCCAAACAATCACAAAGG + Intronic