ID: 1036668882

View in Genome Browser
Species Human (GRCh38)
Location 8:10766537-10766559
Sequence AGGGAGGAGGCTGAGACACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1821
Summary {0: 1, 1: 1, 2: 10, 3: 113, 4: 1696}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668882_1036668894 18 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG No data
1036668882_1036668899 25 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data
1036668882_1036668897 21 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668897 8:10766581-10766603 GGCTTCTTTCCCTCAGCTGGGGG No data
1036668882_1036668895 19 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG No data
1036668882_1036668891 0 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668891 8:10766560-10766582 GAACCAACAGGCCAGCTTGGGGG No data
1036668882_1036668889 -2 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668889 8:10766558-10766580 CTGAACCAACAGGCCAGCTTGGG No data
1036668882_1036668888 -3 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668888 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG No data
1036668882_1036668900 26 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668882_1036668890 -1 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668890 8:10766559-10766581 TGAACCAACAGGCCAGCTTGGGG No data
1036668882_1036668896 20 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG No data
1036668882_1036668898 24 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668882 Original CRISPR AGGGAGGAGGCTGAGACACG CGG (reversed) Intronic
900130401 1:1084875-1084897 CGGGAGGAGCCTCAGGCACGAGG + Intronic
900159597 1:1217268-1217290 AGGGAGGAGGCGGCGCCGCGGGG + Exonic
900175244 1:1288627-1288649 CGGGACGGGGCAGAGACACGGGG - Intronic
900175528 1:1289823-1289845 CGGGACGGGGCAGAGACACGGGG - Intronic
900254244 1:1689061-1689083 ACACAGGAGGCTGAGGCACGAGG + Intronic
900263007 1:1742324-1742346 ACACAGGAGGCTGAGGCACGAGG + Intronic
900355530 1:2260647-2260669 AGCCAGGAGGCTGAGGCAGGAGG - Intronic
900626483 1:3610983-3611005 GAGGAGGTGGCTGAGACACAGGG - Intronic
900660887 1:3782849-3782871 ACTCAGGAGGCTGAGACAGGAGG + Intronic
900664932 1:3808772-3808794 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
900786757 1:4654619-4654641 AGGGAGGCGGCTGAGCAGCGCGG + Intergenic
900943176 1:5814364-5814386 TTGGAGGAGGCAGAGACAAGCGG - Intergenic
900967694 1:5970392-5970414 ACTTAGGAGGCTGAGACAGGAGG + Intronic
901215779 1:7554593-7554615 AGGGTGGAGGCAGTGACAGGAGG - Intronic
901250848 1:7778423-7778445 ACTCAGGAGGCTGAGACAGGAGG + Intronic
901419033 1:9137779-9137801 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
901526963 1:9829592-9829614 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
901534658 1:9874361-9874383 AGTTAGGAGGCTGAGGCAGGAGG - Intronic
901634964 1:10666276-10666298 AGGGAGGAGACTGAGGAACACGG - Intronic
901687567 1:10951614-10951636 ACTCAGGAGGCTGAGACAGGAGG + Intronic
901688978 1:10960293-10960315 ACTCAGGAGGCTGAGGCACGAGG + Intronic
901698830 1:11032125-11032147 ACTGAGGAGGCTGAGACAGGAGG + Intronic
901737406 1:11321104-11321126 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
901793214 1:11665151-11665173 ATGCAGGAGGCTGAGGCAGGAGG - Intronic
901945770 1:12702347-12702369 ACGTGGGAGGCTGAGGCACGAGG + Intergenic
902042518 1:13503106-13503128 CTGGAGGAGGCTGACACAAGAGG + Intronic
902107584 1:14050697-14050719 AGGGAGGAGGCTGAGAGTCTGGG - Intergenic
902527092 1:17066263-17066285 TGGGGGGAGGCTGAGGCAAGAGG - Intergenic
902563224 1:17291656-17291678 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
902588010 1:17453326-17453348 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
903042795 1:20543815-20543837 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
903159100 1:21472055-21472077 AGGAAGGAGGCTGTGACGGGAGG + Intronic
903353971 1:22735192-22735214 AGGCAGGAGGGTGAGGCAGGAGG + Intronic
903415057 1:23176988-23177010 ACTGTGGAGGCTGAGACAGGAGG - Intronic
903609843 1:24602656-24602678 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
903651008 1:24922057-24922079 ACTCAGGAGGCTGAGACAGGAGG - Intronic
903709576 1:25312809-25312831 ACTCAGGAGGCTGAGACAGGAGG + Intronic
903717541 1:25379611-25379633 ACTCAGGAGGCTGAGACAGGAGG - Intronic
904060351 1:27704827-27704849 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
904094057 1:27964091-27964113 ACTCAGGAGGCTGAGACAGGAGG - Intronic
904455467 1:30645409-30645431 AGGGAGGAGGCTGAGGCGGGAGG - Intergenic
904588411 1:31593194-31593216 AGGGAGGAGACTGAGGCTGGGGG + Intergenic
904938735 1:34150188-34150210 AGTCAGGAGGCTGAGGCAAGAGG - Intronic
905079113 1:35301435-35301457 AGTCAGGAGACTGAGACAGGAGG + Intronic
905101595 1:35528194-35528216 ACTCAGGAGGCTGAGACAAGAGG - Intronic
905184616 1:36187544-36187566 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
905219541 1:36435201-36435223 ACTCAGGAGGCTGAGACAGGAGG - Intronic
905406926 1:37739983-37740005 ACGTGGGAGGCTGAGACAGGAGG + Intronic
905478248 1:38243988-38244010 GAGGAGGAAACTGAGACACGGGG + Intergenic
905516221 1:38564031-38564053 CTGGAGGACACTGAGACACGGGG - Intergenic
905553195 1:38859912-38859934 AGGGGGGAGGAGGAGTCACGAGG + Intronic
905555788 1:38883029-38883051 TGGGAGGAGGCTGAGACAGGCGG + Intergenic
905934933 1:41815876-41815898 ACTCAGGAGGCTGAGACAGGAGG - Intronic
905935027 1:41816568-41816590 ACTCAGGAGGCTGAGACATGAGG + Intronic
905973273 1:42156562-42156584 ACACAGGAGGCTGAGACAGGAGG + Intergenic
906002069 1:42435122-42435144 ATGGAGAAAACTGAGACACGGGG - Intronic
906093455 1:43202672-43202694 ACTCAGGAGGCTGAGACAGGAGG + Intronic
906208051 1:43997453-43997475 AGGGGGCAGGCAGAGACACCTGG + Intronic
906335674 1:44928041-44928063 AGTGAGGAAGCTGAGGCAGGGGG + Intronic
906357588 1:45120570-45120592 AGGAAGGATGCTGAGGCAGGAGG - Intronic
906386833 1:45377109-45377131 AATGGGGAGGCTGAGACAGGAGG + Intronic
906502305 1:46350287-46350309 AGCTAGGAGGCTGAGGCAGGTGG + Intronic
906516021 1:46439321-46439343 AGAGAGGAGGCTCAGAAAGGGGG + Intergenic
906674272 1:47681944-47681966 AGGCTGGAGGCTGAGAAACCAGG - Intergenic
907060989 1:51424792-51424814 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
907181618 1:52575558-52575580 AGGCTGGAGGCTGAGGCAGGAGG - Intergenic
907339482 1:53724780-53724802 AGTGGTGAGGCTGAGACAGGAGG - Intronic
907345640 1:53777126-53777148 AGTGAGGAGGCTGAGACAGGAGG - Intronic
907542077 1:55224864-55224886 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
907848237 1:58229073-58229095 ACCGAGGAGGCTGAGGCAGGAGG - Intronic
908218314 1:61977769-61977791 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
908227691 1:62072481-62072503 ACTCAGGAGGCTGAGACAGGAGG + Intronic
908272773 1:62437012-62437034 CGGGCGGAGGCTAAAACACGGGG + Exonic
908358755 1:63347283-63347305 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
908524306 1:64973009-64973031 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
909173108 1:72319418-72319440 ACTTAGGAGGCTGAGACAGGAGG + Intergenic
910393541 1:86769023-86769045 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
910682639 1:89883083-89883105 ACTGAGGAGGCTGAGACGGGAGG + Intronic
910925690 1:92396275-92396297 ACTGAGGAGGCTGAGGCAGGAGG - Exonic
911169851 1:94759078-94759100 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
911787228 1:101966271-101966293 ACTCAGGAGGCTGAGACACAAGG - Intronic
912019666 1:105091248-105091270 ACTTGGGAGGCTGAGACACGAGG + Intergenic
912261789 1:108118184-108118206 AGGGAGTAGGCTGAAAGAGGAGG + Intergenic
912329355 1:108803595-108803617 AGTCAGGAGGCTGAGACACGAGG - Intronic
912349877 1:109001780-109001802 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
912420501 1:109539385-109539407 AGGGAGGCGGCTGAGGCTCCAGG - Intergenic
912498241 1:110105196-110105218 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
912551344 1:110487441-110487463 AGGGAGGAAGCTGAGGCTTGGGG + Intergenic
912773284 1:112485350-112485372 ACACAGGAGGCTGAGGCACGAGG + Intronic
912971811 1:114290586-114290608 AGGGAGGATGCTTGGACACAGGG + Intergenic
913028185 1:114868245-114868267 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
913098669 1:115543069-115543091 ACGCAGGAGGCTGAGGCAGGAGG - Intergenic
913107666 1:115629439-115629461 AGGAAGCAGGCTGGGATACGGGG - Intergenic
913138460 1:115915776-115915798 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
913521260 1:119647803-119647825 GAGGAGGAGGCTGAGACTTGAGG - Intergenic
913543133 1:119841101-119841123 AGGAAGGAGGCTGTGAAAGGAGG - Intergenic
913658304 1:120982858-120982880 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
913990554 1:143608009-143608031 AGGAAGGAGGCTGTGACTGGAGG - Intergenic
914009666 1:143765947-143765969 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
914381416 1:147119803-147119825 AGGAAGGAGGCTGTGACAGGAGG - Intergenic
914648286 1:149674623-149674645 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
914794968 1:150912559-150912581 AGTGAGAAGGCTGAGAAACAGGG - Intergenic
914843720 1:151268656-151268678 ATGCAGGAGGCTGAGGCAGGAGG - Intergenic
914895797 1:151671344-151671366 AGTGGGGAGGCTGAGGCAGGAGG - Intronic
914940844 1:152021647-152021669 AAGAAGGAGGCTGTGACAGGAGG + Intergenic
915108013 1:153546348-153546370 AGTCAGGAAGCTGAGACAGGAGG + Intronic
915172100 1:153985465-153985487 TGGGAGGAGGATGAGTCACCAGG + Intronic
915217405 1:154349335-154349357 AGAGCAGAGGCTGAGGCACGGGG + Exonic
915375297 1:155389112-155389134 ACTCAGGAGGCTGAGACAGGAGG - Intronic
915429931 1:155858813-155858835 ACTTGGGAGGCTGAGACACGAGG - Intronic
915726031 1:158018327-158018349 AGGGAGTAGGCAGAGTCAGGGGG + Intronic
915867522 1:159519478-159519500 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
916227473 1:162503500-162503522 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
916461963 1:165034556-165034578 AGAGAGGAGGCAGAGAGAGGGGG + Intergenic
916808442 1:168283099-168283121 ACGCAGGAGGCTGAGGCAAGGGG + Intronic
917065702 1:171090980-171091002 AGGTAGGAGGCTGAGGCGGGTGG + Exonic
917335458 1:173920401-173920423 AGTGGGGAGGCTGAGGCAGGAGG - Intergenic
917413948 1:174788818-174788840 ACACAGGAGGCTGAGGCACGAGG - Intronic
917414068 1:174790099-174790121 GCACAGGAGGCTGAGACACGAGG + Intronic
917939411 1:179903185-179903207 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
918007068 1:180551424-180551446 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
918367460 1:183823893-183823915 ATCCAGGAGGCTGAGACAGGAGG - Intronic
918407398 1:184224382-184224404 AGAGAGGAGGCAGAGACCTGGGG - Intergenic
918476923 1:184934959-184934981 ACCCAGGAGGCTGAGACAGGAGG + Intronic
918492557 1:185097640-185097662 ACTCAGGAGGCTGAGACAGGAGG - Intronic
919067084 1:192706113-192706135 AGGAAGGAATCTGAGACAGGTGG + Intergenic
919268952 1:195313275-195313297 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
919555937 1:199053078-199053100 ATGTAGGAGGCTGAGGCAGGAGG + Intergenic
919653657 1:200176744-200176766 ATGGGGGAGGCTGAGGCAGGAGG - Exonic
919663591 1:200271254-200271276 AGTGAGGAGGCCGAGGCAGGTGG - Intergenic
919807596 1:201389567-201389589 CTTTAGGAGGCTGAGACACGCGG + Intronic
919908933 1:202098022-202098044 ACGCAGGAGGCTGAGGCAGGAGG + Intergenic
919914600 1:202131679-202131701 ACTCAGGAGGCTGAGACAGGAGG - Exonic
920009177 1:202855358-202855380 ACTGAGGAGGCTGAGACAGGAGG + Intergenic
920221167 1:204402514-204402536 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
920253238 1:204636654-204636676 ACTCAGGAGGCTGAGACAGGAGG + Intronic
920392097 1:205613224-205613246 ATGCAGGAGGCTGAGGCAGGAGG + Exonic
920426100 1:205876901-205876923 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
920587352 1:207179590-207179612 AGGGATGAGGGAGAGACAAGGGG + Intergenic
920970415 1:210738674-210738696 ACTGAGGAGGCTGAGACAGGAGG - Intronic
921022659 1:211250368-211250390 AGGAAGGAGGCTGAAGCAGGAGG + Intergenic
921558514 1:216628361-216628383 AGTCAGGAGGCTGAGAAAGGAGG - Intronic
921570178 1:216768596-216768618 ACTGAGGAGGCTGAGGCAAGAGG - Intronic
921606373 1:217160443-217160465 ACTGAGGAGGCTGAGGCAAGAGG - Intergenic
921765503 1:218968294-218968316 AGTGAGGACACTGAGACACTAGG - Intergenic
921891212 1:220355735-220355757 ACTCAGGAGGCTGAGACAGGGGG + Intergenic
922096682 1:222448971-222448993 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
922266734 1:223991432-223991454 AGTTAGGAGGCTGAGGCAGGAGG - Intergenic
922725429 1:227920834-227920856 AGGGAGGAAGCTGAGGCCCAGGG + Exonic
923069122 1:230546674-230546696 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
923176061 1:231466854-231466876 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
923456757 1:234171307-234171329 TGGGATGAGGCTGGGACACAGGG + Intronic
923540944 1:234887781-234887803 AGGCAAGAGGCTGAGCCACCTGG - Intergenic
923687934 1:236166893-236166915 AGGGAGGAGGCTGAAATGGGAGG - Intronic
923902228 1:238338856-238338878 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
924225602 1:241919304-241919326 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
924349362 1:243100595-243100617 AGTTAGGAGGCTGAGGCAGGAGG - Intergenic
924409151 1:243785004-243785026 ACGGGGGAGGCTGAGGCAGGAGG - Intronic
924428453 1:243975183-243975205 ACAGAGGAGGCTGAGGCAGGAGG + Intergenic
924481751 1:244441583-244441605 ACTCAGGAGGCTGAGACAGGAGG - Intronic
924591467 1:245408461-245408483 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1062780380 10:199536-199558 AAGGAGGAGGCTGACACAGGAGG - Intronic
1063145763 10:3293879-3293901 AGGGAGGAGGCTGAGACATGAGG + Intergenic
1063394508 10:5674362-5674384 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1063660584 10:8033253-8033275 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1064072917 10:12245959-12245981 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1064214410 10:13387529-13387551 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1064234665 10:13563206-13563228 TGGGAGGTGGTTGAGTCACGGGG - Intergenic
1064248118 10:13685697-13685719 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1064249318 10:13694731-13694753 ACTGGGGAGGCTGAGACAAGAGG + Intronic
1064263529 10:13805795-13805817 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1064275564 10:13902123-13902145 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1064310137 10:14204994-14205016 AGGGTTAAGGCAGAGACACGTGG - Intronic
1064323568 10:14328496-14328518 AAGTAGGAGGCTGAGACAAGCGG + Intronic
1064445465 10:15388907-15388929 ACCCAGGAGGCTGAGACAGGAGG + Intergenic
1064450608 10:15438991-15439013 AGGCAGGAGGCTGAGATGGGAGG + Intergenic
1064475555 10:15684614-15684636 CTTGAGGAGGCTGAGACAAGAGG - Intronic
1064557984 10:16566626-16566648 AGGGAGGAGGCAGAGAAAGGGGG + Intergenic
1064641698 10:17421669-17421691 AGTGGGGAGGCTGAGGCAGGAGG - Intronic
1064865809 10:19878308-19878330 ACTTAGGAGGCTGAGACAGGAGG - Intronic
1064888390 10:20138802-20138824 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1064923647 10:20546424-20546446 AGCCAGGAGGCTGAGGCAGGAGG + Intergenic
1064965985 10:21015618-21015640 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1064997111 10:21305880-21305902 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1065005729 10:21378464-21378486 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
1065073749 10:22055036-22055058 AGGGGAGAGGCTGAGAGATGGGG - Intergenic
1065146951 10:22779293-22779315 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1065383678 10:25113977-25113999 AGGGTGGAGGTGGAGACAAGTGG - Intergenic
1065661952 10:28013503-28013525 AGTGGGGAGGCTGAGGCAGGAGG - Intergenic
1065670786 10:28114301-28114323 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1065797427 10:29319992-29320014 ATTGAGGAGGCTCAGACAAGAGG + Intergenic
1065847334 10:29756890-29756912 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1065901835 10:30214900-30214922 AGGGAGGAGGGAGAGAGACGAGG - Intergenic
1066114697 10:32229404-32229426 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1066134622 10:32432641-32432663 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1066270214 10:33815108-33815130 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1066427962 10:35325965-35325987 TGGGAGGAGGCTGAGGTAGGAGG + Intronic
1066727005 10:38404334-38404356 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
1067094566 10:43291153-43291175 ACTCAGGAGGCTGAGACAGGTGG + Intergenic
1067270270 10:44785656-44785678 AGGCAGGAGGCTGTGGAACGAGG - Intergenic
1067485044 10:46640686-46640708 ACGTAGGAGGCTGAGGCAGGAGG - Intergenic
1067496255 10:46762970-46762992 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1067598400 10:47577423-47577445 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1067925049 10:50500057-50500079 AGTCAGGAGGCTGAGGCAAGAGG + Intronic
1068285768 10:54932643-54932665 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1068316519 10:55350991-55351013 AGGGAGGGGGAGGAGACAGGGGG - Intronic
1068502023 10:57852060-57852082 ACTTAGGAGGCTGAGACAGGAGG - Intergenic
1068542606 10:58312382-58312404 AGGGAGGAGGCAGGGAAACAGGG - Intergenic
1068591280 10:58855569-58855591 ACGGAGGAGGCTGAGATGGGAGG - Intergenic
1068677074 10:59779298-59779320 AGGCAGGAGGCTGAGGTAAGAGG + Intergenic
1068901715 10:62277120-62277142 ACGCAGGAGGCTGAGGCAGGAGG + Intergenic
1069021709 10:63495662-63495684 ACGTGGGAGGCTGAGACAGGTGG + Intergenic
1069128192 10:64664819-64664841 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1069437397 10:68397668-68397690 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1069558514 10:69413544-69413566 AGGGAGGGGGCAGAGACCCTGGG + Intronic
1069757060 10:70779805-70779827 AGGGAAGAGGCTGAGAGGCAGGG + Intronic
1069761320 10:70813439-70813461 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1069907263 10:71739226-71739248 AGAGAGGAGGCTCAGAAACATGG - Intronic
1069970331 10:72162576-72162598 ATGCAGGAGGCTGAGGCAGGAGG - Intronic
1070125635 10:73619334-73619356 ACGTAGGAGGCTGAGGCAAGAGG - Intronic
1070158534 10:73851373-73851395 AGGGCAGAGGCTGAGGCATGTGG + Intronic
1070539759 10:77407682-77407704 ATGGAAGAGGCTGAGACTCAAGG - Intronic
1070579462 10:77709109-77709131 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1071027176 10:81128959-81128981 AGGGAGGAGGCCCAGATAAGAGG + Intergenic
1071272072 10:84017121-84017143 AGTCAGGAGGCTGAGTCAGGAGG + Intergenic
1071284286 10:84129967-84129989 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1071507769 10:86242997-86243019 GGCGAGGAAGCTGAGACACAGGG - Intronic
1071777065 10:88800940-88800962 GTGGAGGAGGCTGAGTCATGTGG + Intergenic
1072048849 10:91683653-91683675 ATAGAGGAGGCTCACACACGGGG - Intergenic
1072185321 10:93032226-93032248 AGTCAGGAGGCTGAGTCAGGAGG + Intronic
1072248261 10:93561768-93561790 ACGCAGGAGGCTGAGGCAAGAGG + Intergenic
1072426821 10:95337049-95337071 ATGGGGGAGGCTGAGAGACAGGG + Exonic
1072428402 10:95349934-95349956 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1072441500 10:95460058-95460080 ATGGAGGAGAATGAGACACAGGG + Intronic
1072805165 10:98419396-98419418 AGAGAGGAGGGAGAGACAGGAGG + Intronic
1072968586 10:99996409-99996431 ACTCAGGAGGCTGAGACACGAGG + Intronic
1073276252 10:102314252-102314274 AGTTGGGAGGCTGAGACAGGAGG - Intronic
1073409236 10:103325912-103325934 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1073428084 10:103468499-103468521 ATGGGGGAGGCTGAGGCATGTGG - Intergenic
1074096891 10:110321590-110321612 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
1074106740 10:110394455-110394477 AGAGAGGAGGCTGTGGCCCGGGG - Intergenic
1074158051 10:110815399-110815421 AGGGAAGAGGGTGAGACTCATGG + Intronic
1074402844 10:113156221-113156243 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1074446986 10:113528772-113528794 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1074583978 10:114748763-114748785 ACTAAGGAGGCTGAGACAGGAGG - Intergenic
1074596832 10:114875585-114875607 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1074601053 10:114913527-114913549 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1074685994 10:115963048-115963070 AGGGAGGACACTGAGGCACAGGG - Intergenic
1074826670 10:117219861-117219883 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1074999574 10:118785519-118785541 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1075147692 10:119896340-119896362 AGGGAGGAGTCTCAGACTTGAGG + Intronic
1075643116 10:124079611-124079633 AGGGAGGTGGCTGCAACAAGAGG + Intronic
1075763473 10:124874396-124874418 TGGGAGGAGGCCGAGGCAGGTGG - Intergenic
1075838627 10:125477751-125477773 AGGGAGGAGGAAGAGTCACCTGG + Intergenic
1076101754 10:127785912-127785934 GGACAGGAGGCTGAGACAGGAGG + Intergenic
1077159858 11:1107779-1107801 AGGGAGGAGGCTGCCGCCCGGGG + Intergenic
1077186156 11:1236318-1236340 AGGGAGGGGCCTGAGACCCAGGG - Intronic
1077242531 11:1518105-1518127 AAGGAGGTGGCTGAGAAACAAGG + Intergenic
1077246000 11:1538843-1538865 ATGTGGGAGGCTGAGACAGGAGG - Intergenic
1077246540 11:1542029-1542051 AGAGAGGAGGCTGAGGCTCCTGG + Intergenic
1077479660 11:2807682-2807704 GGGGAGGAGGCTGAGGGAAGGGG - Intronic
1077485211 11:2835295-2835317 AGGGAGGTGGCAGAGACTTGGGG - Intronic
1077619227 11:3704898-3704920 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1077666101 11:4111084-4111106 AGTGAGGAGGCTGAGATGGGAGG + Intronic
1078022992 11:7670991-7671013 AGGGAGGAGGAGGAGGCAGGAGG + Intronic
1078215010 11:9304592-9304614 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1078219319 11:9338206-9338228 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1078378713 11:10819847-10819869 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1079292779 11:19203298-19203320 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1079446180 11:20558254-20558276 CAGGAGGAGGCTGAGGCACGAGG - Intergenic
1079650343 11:22920605-22920627 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1079817606 11:25081275-25081297 TGGGAGGAGACTGAGGCAGGTGG - Intronic
1079966887 11:26990817-26990839 ACACAGGAGGCTGAGGCACGAGG + Intergenic
1079987140 11:27211258-27211280 ACTGAGGAGGCTGAGGCAAGAGG + Intergenic
1080490066 11:32752909-32752931 GGGCAGGAGGCTGAGGCAGGAGG - Intronic
1080528269 11:33148933-33148955 ACGTGGGAGGCTGAGACAGGAGG - Intronic
1080757918 11:35219933-35219955 AGTGAGGAGGCTGGGACACCTGG + Intronic
1081047677 11:38296414-38296436 AGGGAGGCGACTGAGGCCCGGGG + Intergenic
1081480796 11:43486938-43486960 AGGTAGGAGGCTGAGACAGGAGG + Intronic
1081481822 11:43496564-43496586 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1081869105 11:46375281-46375303 AGAGGGGAGGCTGAGACCCCAGG - Intronic
1081902379 11:46639960-46639982 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1081913700 11:46717906-46717928 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1082022175 11:47543663-47543685 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1083181856 11:60991776-60991798 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1083359174 11:62093571-62093593 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1083597397 11:63924790-63924812 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1083978193 11:66141707-66141729 ACGTAGGAGGCTGAGGCACCAGG - Intronic
1084034644 11:66501714-66501736 ACAGAGGAGGCTGAGGCAGGAGG + Intronic
1084104414 11:66971725-66971747 AGTCAGGAGGCTGTGACAGGAGG + Intergenic
1084108026 11:66993356-66993378 ACTGGGGAGGCTGAGACAGGAGG + Intergenic
1084234443 11:67777671-67777693 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1084325720 11:68398841-68398863 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1084437705 11:69154046-69154068 AGCTAGGAGGCTGAGGCAGGAGG - Intergenic
1084474146 11:69379149-69379171 AGGGAGGATGCTGAGTAAGGGGG - Intergenic
1084524498 11:69687120-69687142 AGGCAGGACTCTGAGACAGGTGG + Intergenic
1084531818 11:69731905-69731927 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1084687584 11:70706037-70706059 AGGGAGCAGGCAGGGCCACGTGG - Intronic
1084687595 11:70706080-70706102 AGGGAGCAGGCAGGGCCACGTGG - Intronic
1084766914 11:71317174-71317196 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1084895012 11:72259893-72259915 AATCAGGAGGCTGAGACAAGGGG - Intergenic
1084898031 11:72289677-72289699 ACGTAGGAGGCTGAGGCAGGAGG - Intergenic
1084908836 11:72371170-72371192 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1084923777 11:72495317-72495339 ACTCAGGAGGCTGAGACAGGGGG - Intergenic
1084990851 11:72924182-72924204 ATTTAGGAGGCTGAGACAGGCGG - Intronic
1085016951 11:73180024-73180046 ACGCAGGAGGCTGAGGCAGGAGG + Intergenic
1085044322 11:73344382-73344404 AGGGAGGAGGCTGGGAGAGGCGG + Intronic
1085078671 11:73615154-73615176 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1085403471 11:76248092-76248114 AGGGAGGAGGGTGTGGCACAGGG - Intergenic
1085418030 11:76332402-76332424 ATTTAGGAGGCTGAGACAGGAGG - Intergenic
1085477724 11:76798449-76798471 AGGAAGGAGGTTGAGAGACAGGG - Intergenic
1085479001 11:76806334-76806356 AGGGAGCAGGCTCAGAGAGGTGG - Intergenic
1085526982 11:77169965-77169987 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1085630524 11:78112166-78112188 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1085958224 11:81427397-81427419 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1086068447 11:82771588-82771610 TGGGAGGAGGGTGAGGCAGGCGG - Intergenic
1086092197 11:83016027-83016049 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1086614080 11:88793932-88793954 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1086996938 11:93368825-93368847 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1087090895 11:94271596-94271618 AGTTGGGAGGCTGAGACAGGAGG - Intergenic
1087231950 11:95676170-95676192 AGAGAGGAGGGTGAGAAAGGTGG - Intergenic
1087808200 11:102579419-102579441 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1088682515 11:112256019-112256041 ACGGAAGAGGCTGATGCACGTGG + Intronic
1088834007 11:113561904-113561926 AGGGAGAAGGCAGAGAGACAAGG + Intergenic
1088963238 11:114691890-114691912 AGGGAGCAGGCTGGGACACCAGG + Intronic
1088997048 11:115010290-115010312 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1089068949 11:115683832-115683854 ACTCAGGAGGCTGAGACATGAGG + Intergenic
1089127399 11:116186334-116186356 AGGTGGGAGGCTGAGGCAGGTGG + Intergenic
1089209038 11:116788420-116788442 GGGGAAGAGGCTGAGCCACCCGG - Intergenic
1089244717 11:117110600-117110622 AGGGAGGCAGCTGAGGCCCGGGG + Intergenic
1089300163 11:117493734-117493756 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1089302892 11:117509282-117509304 ACGGAGGAGGCTGAGCCAAGGGG + Intronic
1089340293 11:117752795-117752817 AGGGATGAGGCTGCAGCACGAGG + Intronic
1089377333 11:118003876-118003898 AGGCAGGAGGCAGAGAAACAGGG + Intergenic
1089433733 11:118444680-118444702 ACTTAGGAGGCTGAGACAAGAGG - Intronic
1089628519 11:119768564-119768586 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1089817236 11:121187293-121187315 AGGAAGGGGGCTGAGAAAAGTGG + Intronic
1089992931 11:122878701-122878723 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1090014517 11:123074281-123074303 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1090022740 11:123142091-123142113 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1090038785 11:123272076-123272098 AGAGAGGAGGGTGAATCACGAGG + Intergenic
1090296075 11:125589890-125589912 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1090552731 11:127840850-127840872 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1091559485 12:1600542-1600564 AGTCAGGAGGCTGAGGCAAGCGG + Intronic
1091979406 12:4853300-4853322 AAGGTGGAGGCTGGGACATGGGG - Intergenic
1092496646 12:9002673-9002695 ACTTAGGAGGCTGAGACAGGAGG - Intronic
1092501302 12:9050718-9050740 AGGCAGGAGCCAGGGACACGTGG + Intergenic
1092660283 12:10731452-10731474 AGGCAGGAGGCTGAGGTAGGAGG - Intergenic
1093144937 12:15554083-15554105 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1093150647 12:15617096-15617118 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1093399070 12:18721293-18721315 AGGGATGAGGCTGAGGAACTTGG + Intronic
1093422919 12:18995636-18995658 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1093716463 12:22388567-22388589 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1093833246 12:23792512-23792534 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
1094016894 12:25874385-25874407 AGGGAGGAGGGTCGGACAAGAGG + Intergenic
1094028444 12:25984167-25984189 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1094098200 12:26731687-26731709 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1094160681 12:27386736-27386758 ACTGAGGAGGCTGAGACGGGAGG - Intronic
1094639119 12:32256159-32256181 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1094698765 12:32847855-32847877 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1095703053 12:45210329-45210351 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1095710837 12:45286241-45286263 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1095883119 12:47160408-47160430 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1096037454 12:48485183-48485205 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1096092183 12:48909887-48909909 ATGCAGGAGGCTGAGGCAGGAGG - Intronic
1096133640 12:49181193-49181215 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1096213125 12:49781628-49781650 AGTTGGGAGGCTGAGACAGGAGG - Intergenic
1096274167 12:50191415-50191437 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1096278591 12:50232166-50232188 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1096320131 12:50604564-50604586 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1096398249 12:51283554-51283576 ATGCAGGAGGCTGAGGCAGGAGG - Intronic
1096441600 12:51648309-51648331 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1096498403 12:52051511-52051533 AGGGACCAGGCTGAGACTCGGGG + Intronic
1096530853 12:52242076-52242098 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1096560140 12:52430271-52430293 TGGGAGCAGGGTGAGACACCAGG - Intronic
1096641263 12:52996198-52996220 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1096677133 12:53231991-53232013 AGGGAGGCGGCGGAGCCCCGAGG + Exonic
1096682407 12:53265196-53265218 TGGGAGGAGGCTGAGGCAGGAGG - Intergenic
1097042198 12:56162561-56162583 AGGGGAGAAGCTGGGACACGTGG + Intronic
1097197799 12:57253597-57253619 AGGGAAGAGGATGAGACAGAGGG + Intronic
1097333481 12:58356988-58357010 AGGGAGATGACTGAGTCACGTGG + Intergenic
1097479172 12:60099676-60099698 TGGGAGCAGGCTGGGACAAGTGG + Intergenic
1098000077 12:65931802-65931824 TGACAGGAGGCTGAGACAAGAGG + Intronic
1098070464 12:66668839-66668861 AGGGAGGCTGCCGAGACAGGAGG + Intronic
1098215720 12:68215774-68215796 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1098234716 12:68407451-68407473 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1098337628 12:69420256-69420278 AGGGAGGAGGCAGGGAGACCAGG + Intergenic
1098555818 12:71817735-71817757 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1098710960 12:73761016-73761038 AGGTGGGAGGCTGAGGCAGGAGG - Intergenic
1098965885 12:76787965-76787987 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1099182615 12:79485578-79485600 ACTCAGGAGGCTGAGGCACGGGG - Intergenic
1099443848 12:82728985-82729007 AGGGCGGAGGCTCAGGCATGGGG - Intronic
1100393771 12:94166873-94166895 ATTTAGGAGGCTGAGACAGGTGG - Intronic
1100471922 12:94901325-94901347 AGTCAGGAGGCTGAGATAGGAGG + Intronic
1100534400 12:95493230-95493252 ACTCAGGAGGCTGAGACAGGGGG + Intronic
1100572157 12:95852978-95853000 ACTCAGGAGGCTGAGACACAAGG - Intergenic
1100627841 12:96354773-96354795 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1100954760 12:99894398-99894420 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1101135694 12:101740787-101740809 ACGCAGGAGGCAGAGACAGGGGG - Intronic
1101346580 12:103891529-103891551 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1101606512 12:106250760-106250782 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1101887713 12:108681107-108681129 ATGTAGGAGGCTGAGGCAGGAGG - Intronic
1101901659 12:108795356-108795378 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1101947234 12:109146781-109146803 AGTCAGGAGGCTGAGACGGGAGG - Intronic
1101950979 12:109174759-109174781 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1101954334 12:109199902-109199924 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
1102171168 12:110843625-110843647 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1102205645 12:111089054-111089076 GGTGAGGAGACTGAGGCACGGGG + Intronic
1102275482 12:111578927-111578949 AGCCAGGAGGCTGAGGCAGGAGG + Intronic
1102314710 12:111877933-111877955 AGTTAGGAGGCTGAGGCAGGAGG - Intronic
1102327854 12:112004087-112004109 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1102334617 12:112067599-112067621 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1102387427 12:112521368-112521390 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1102424367 12:112829377-112829399 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1102460054 12:113094467-113094489 ACGTAGGAGGCTGAGGCAGGAGG + Intronic
1102541562 12:113623255-113623277 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
1102716996 12:114982493-114982515 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1102823046 12:115924253-115924275 AGGGAGGAGGCAGGGACTCACGG + Intergenic
1102880835 12:116483230-116483252 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1102934697 12:116886471-116886493 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1102955859 12:117058632-117058654 ATGCAGGAGGCTGAGGCAAGAGG + Intronic
1103073233 12:117962034-117962056 ACCCAGGAGGCTGAGACAGGAGG + Intronic
1103113075 12:118299616-118299638 AGTGGGGAGGCCGAGACAGGAGG - Intronic
1103293520 12:119866708-119866730 ACTGAGGAGGCTGAGACAGGAGG + Intronic
1103380284 12:120488802-120488824 ACTGAGGAGGCTGAGACAGGAGG + Intronic
1103405204 12:120670109-120670131 ATGCAGGAGGCTGAGGCAGGAGG - Intergenic
1103499932 12:121393845-121393867 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1103705688 12:122870625-122870647 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1103712328 12:122922018-122922040 AGGGAGGAGGTGGAGACGCCCGG + Intronic
1103717065 12:122950951-122950973 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1103846889 12:123908074-123908096 AGGGAGGAGACAGAGAGACAGGG - Intronic
1103846897 12:123908112-123908134 AGGGAGGAGACAGAGAGACAGGG - Intronic
1103846900 12:123908131-123908153 AGGGAGGAGACAGAGAGACAGGG - Intronic
1103846908 12:123908169-123908191 AGGGAGGAGACAGAGAGACAGGG - Intronic
1103846923 12:123908237-123908259 AGGGAGGAGACAGAGAGACAGGG - Intronic
1104383745 12:128330442-128330464 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1104440474 12:128789621-128789643 CGGCAGGAGCCTGTGACACGTGG + Intergenic
1104587557 12:130059674-130059696 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
1104915359 12:132261686-132261708 AGGCAGGAGGCTGTGCCATGGGG - Intronic
1104995762 12:132654681-132654703 ATGCAGGAGGCTGAGGCAGGTGG + Intronic
1105066867 12:133208544-133208566 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1105479562 13:20761859-20761881 ATGTGGGAGGCTGAGACAGGAGG + Intronic
1105568662 13:21577868-21577890 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1106265563 13:28106387-28106409 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1106381710 13:29245803-29245825 ACTTAGGAGGCTGAGACAGGAGG - Intronic
1106503454 13:30351060-30351082 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1106620183 13:31364992-31365014 AGGCAGGAGACTGGGACAAGTGG + Intergenic
1106673950 13:31937229-31937251 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1107264308 13:38534052-38534074 ACTGAGCAGGCTGAGAAACGAGG + Intergenic
1107408223 13:40135157-40135179 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1107765077 13:43725856-43725878 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1108039407 13:46325311-46325333 TGGGAGGTGGCTGGGTCACGGGG + Intergenic
1108123839 13:47219498-47219520 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1108251327 13:48570788-48570810 AGAGAGGAGGCTTGGAGACGGGG + Intergenic
1108371304 13:49771897-49771919 ATTTAGGAGGCTGAGACAGGTGG - Intronic
1108478132 13:50841619-50841641 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1108501224 13:51071732-51071754 AGGGAGGAAGCTGACACCTGAGG - Intergenic
1108528258 13:51304074-51304096 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1109627253 13:64992005-64992027 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1109699269 13:66004758-66004780 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1109789496 13:67228877-67228899 TAGGAGGAGGGTGAGACAGGGGG - Intronic
1109885958 13:68545355-68545377 ATGTAGGAGGCTGAGATAGGAGG - Intergenic
1110703024 13:78571768-78571790 AATGAGGAAACTGAGACACGGGG - Intergenic
1111295259 13:86269147-86269169 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1111645622 13:91028283-91028305 ACTTAGGAGGCTGAGACAGGAGG + Intergenic
1112001067 13:95210509-95210531 AATCAGGAGGCTGAGACAGGAGG + Intronic
1112122746 13:96431093-96431115 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
1112220829 13:97488081-97488103 AGTCGGGAGGCTGAGGCACGAGG - Intergenic
1112496762 13:99911413-99911435 AGGGAGGAGGCTGAATCAGAGGG - Intergenic
1112562125 13:100524233-100524255 TGGGAAGAGGCTGACACTCGAGG - Intronic
1113133322 13:107061900-107061922 ACTGGGGAGGCTGAGACAGGAGG + Intergenic
1113150888 13:107262304-107262326 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1113159925 13:107368398-107368420 ACGCAGGAGGCTGAGGCAGGAGG - Intronic
1113245394 13:108389371-108389393 ACGCAGGAGGCTGAGGCAGGAGG + Intergenic
1113591920 13:111507360-111507382 AGGGTGGAGGCTGAGGCTGGAGG - Intergenic
1113759979 13:112840393-112840415 AGTAAGGAGGCTGAGGCAGGGGG - Intronic
1113835943 13:113328626-113328648 ACGCAGGAGGCTGAGGCAGGGGG - Intronic
1113840049 13:113353959-113353981 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
1114235451 14:20819776-20819798 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1114315729 14:21508153-21508175 CAGGAGGAGGCTGAGGCAGGAGG + Intronic
1114363072 14:21997565-21997587 AGGGAGGAACCTGAGACTAGGGG + Intergenic
1114368163 14:22053021-22053043 AGGTAGGTGGCTGAGTCACCAGG - Intergenic
1114454595 14:22846698-22846720 AGGAAGGAGCCTGAGCCACTGGG + Exonic
1114477091 14:23003690-23003712 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1115252188 14:31360911-31360933 ATTCAGGAGGCTGAGACAGGAGG - Intronic
1115536116 14:34374932-34374954 AGTGAGGAGGCTGAGGCAGAAGG + Intronic
1115663330 14:35519164-35519186 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1115747343 14:36451166-36451188 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1115997709 14:39211341-39211363 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1117224763 14:53644238-53644260 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1117476286 14:56098310-56098332 TGTGAGGAGGCTGAGCCACATGG - Intergenic
1117702221 14:58425453-58425475 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1118015588 14:61657244-61657266 AGGCGGGAGGCTGAGGCAGGAGG - Intronic
1118015591 14:61657257-61657279 AGGGAGGAGGCTGAGGCGGGAGG - Intronic
1118216833 14:63816823-63816845 ACCCAGGACGCTGAGACACGAGG - Intergenic
1118250397 14:64154682-64154704 ACTTAGGAGGCTGAGGCACGAGG + Intronic
1118642174 14:67803110-67803132 ACTGGGGAGGCTGAGACAGGAGG + Intronic
1118891363 14:69912355-69912377 ACCCAGGAGGCTGAGACAGGAGG - Intronic
1119194593 14:72708179-72708201 GGAGAGGAGGCAGAGACAGGAGG + Intronic
1119476297 14:74931807-74931829 AGGTGGGAGGCTGAGGCAAGAGG + Intergenic
1119476306 14:74931859-74931881 AGGCAGGAGGCTGAGGCAAGAGG + Intergenic
1119786260 14:77316463-77316485 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1119813899 14:77547808-77547830 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1119865300 14:77968246-77968268 ATCCAGGAGGCTGAGACAAGAGG - Intergenic
1120913932 14:89693481-89693503 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
1120966803 14:90174743-90174765 ACGTAGGAGGCTGAGGCAAGAGG + Intronic
1120985061 14:90327438-90327460 ACTCAGGAGGCTGAGACAGGCGG + Intronic
1121002717 14:90463868-90463890 GAGGAGGAGGCCGAGACAGGAGG - Intergenic
1121137885 14:91514572-91514594 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1121618264 14:95328300-95328322 AGGCAGGAGGCTGAGGCAGGAGG + Intergenic
1121765679 14:96483528-96483550 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1121865298 14:97357122-97357144 TGGGGTGAGGCTGAGACACGAGG + Intergenic
1121915019 14:97830895-97830917 AGGGAGGGGGCTGAGATGGGAGG - Intergenic
1122072637 14:99214447-99214469 ACTTAGGAGGCTGAGACAGGAGG + Intronic
1122120188 14:99549043-99549065 AGGGAGGAGGATGACACACAGGG + Intronic
1122196896 14:100094633-100094655 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1122605093 14:102942811-102942833 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1122927081 14:104909174-104909196 ACACAGGAGGCTGAGACAGGAGG + Intergenic
1123222204 14:106867571-106867593 AGGGAGGAGGCTGGGATAAAGGG - Intergenic
1123388990 15:19850666-19850688 GGAGAGGAGGCTGAGGCAGGAGG - Intergenic
1123627258 15:22236343-22236365 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1123905001 15:24912224-24912246 ATTCAGGAGGCTGAGACAGGAGG - Intronic
1124339803 15:28883490-28883512 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1124704112 15:31947042-31947064 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1124796666 15:32787742-32787764 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1124928937 15:34100230-34100252 ACTGAGGAGGCTGAGACAGGAGG + Intronic
1125081922 15:35684762-35684784 AGGGAGGTGGCTGGATCACGGGG - Intergenic
1125254580 15:37748345-37748367 ACGTGGGAGGCTGAGACAGGAGG + Intergenic
1125610500 15:40966229-40966251 AGGGAGACGGCTCAGACACAGGG - Intergenic
1125866009 15:43050058-43050080 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1126615278 15:50572174-50572196 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
1126765957 15:52011301-52011323 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1127116010 15:55727971-55727993 ACTCAGGAGGCTGAGACATGAGG - Intronic
1127183967 15:56458384-56458406 ATGGAGGAGGCTGATAGAAGGGG - Intronic
1127207506 15:56735516-56735538 ACTGAGGAGGCTGAGGCAAGAGG + Intronic
1127384078 15:58453163-58453185 AGAGAGGAGGCTCAGCCAAGCGG - Intronic
1127517757 15:59713019-59713041 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1127595149 15:60474015-60474037 ACTTAGGAGGCTGAGGCACGAGG - Intronic
1127597378 15:60499427-60499449 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1127985418 15:64066490-64066512 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1128027669 15:64452067-64452089 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1128206293 15:65855376-65855398 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1128509261 15:68303405-68303427 CAGGAGGAGGCTGAGACCAGGGG + Intronic
1128605689 15:69035280-69035302 AGGGAGGTGGCTGGGAAAAGAGG + Intronic
1128634421 15:69294030-69294052 GGGGAAGATGCTGAGACAGGAGG - Intergenic
1128938126 15:71765345-71765367 ACGAAGCAGGCTGAGTCACGGGG - Intronic
1129288051 15:74541368-74541390 GGAGAGGAGGCTGCGACAGGTGG + Intronic
1129376292 15:75134811-75134833 ACTAAGGAGGCTGAGACAGGAGG - Intergenic
1129973490 15:79801493-79801515 ACCCAGGAGGCTGAGACAGGAGG - Intergenic
1130089851 15:80811661-80811683 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1130113169 15:80983132-80983154 ACTCAGGAGGCTGAGACACGAGG + Intronic
1130626440 15:85520387-85520409 ACTCAGGAGGCTGAGACATGAGG + Intronic
1131019484 15:89086521-89086543 AGTGGGGAGGCTGAGGCAGGAGG - Intergenic
1131027478 15:89156627-89156649 ATTCAGGAGGCTGAGGCACGAGG + Intronic
1131135012 15:89927789-89927811 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1131197346 15:90366278-90366300 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1131246987 15:90803052-90803074 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1131274608 15:90970415-90970437 AAGGAGGAAGTCGAGACACGGGG + Exonic
1131711008 15:95056619-95056641 AGGGGGAAGGCTGAGACGAGGGG - Intergenic
1131853925 15:96571805-96571827 CAGGAGGAGGCTGAGAAATGTGG + Intergenic
1131989488 15:98079739-98079761 AGGGAGGATGGTGAGACAAAGGG - Intergenic
1132137023 15:99351453-99351475 AGGGAGGAAGTTGAGAAAGGGGG - Intronic
1132664999 16:1077530-1077552 ACTGAGGAGGCTGAGTCAGGAGG - Intergenic
1132666721 16:1084301-1084323 ACTGGGGAGGCTGAGACAGGAGG + Intergenic
1132672661 16:1108104-1108126 AGGGAGGAGCCTGAGGCCCCAGG - Intergenic
1132715769 16:1289172-1289194 AGGGAGGAGGCAGAGAGACCTGG - Intergenic
1132747232 16:1442023-1442045 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1133094989 16:3438121-3438143 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1133126271 16:3648200-3648222 TGGCAGGAGGCTGAGGCAGGAGG + Intronic
1133171116 16:3983061-3983083 AGGGAGGATGCTGGGGCACAGGG + Intronic
1133297440 16:4761746-4761768 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1133493432 16:6294071-6294093 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1133775176 16:8889911-8889933 AGCGAGGAGGCAGAGAAAGGTGG - Intergenic
1133796284 16:9049083-9049105 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1133890331 16:9873195-9873217 AGGGAGGAGGCTGAGGGAAGAGG + Intronic
1134061889 16:11204279-11204301 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1134100135 16:11446256-11446278 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1134115475 16:11544584-11544606 ACGCAGGAGGCTGAGGCAAGCGG + Intergenic
1134116837 16:11555270-11555292 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1134168449 16:11949038-11949060 AGGGAGGCGGCTGAGATGGGAGG + Intronic
1134220965 16:12353579-12353601 AGGGAGGAGGCGGAGAGAGGTGG - Intronic
1134603588 16:15552329-15552351 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1134612210 16:15618444-15618466 AGGGAAGGGGCTGAGAGACTCGG - Intronic
1134617152 16:15660362-15660384 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1134980585 16:18605490-18605512 ACGTGGGAGGCTGAGGCACGTGG + Intergenic
1135041852 16:19123471-19123493 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1135053757 16:19213616-19213638 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1135069357 16:19338619-19338641 GGGGATGAAGCTGAGACAGGTGG + Intergenic
1135123489 16:19786587-19786609 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1135322835 16:21508365-21508387 AGGCAGGAGGCTGAGGCAGGAGG - Intergenic
1135349581 16:21717330-21717352 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1135351952 16:21736720-21736742 ACTCAGGAGGCTGAGACACGAGG + Intronic
1135450443 16:22552843-22552865 ACTCAGGAGGCTGAGACACGAGG + Intergenic
1135505718 16:23034397-23034419 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1135534809 16:23285279-23285301 ACTGGGGAGGCTGAGACAAGAGG - Intronic
1135701924 16:24640289-24640311 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1135728242 16:24873528-24873550 AGTCAGGAGGCTGAGGCAAGAGG + Intronic
1135871855 16:26158498-26158520 ACTCAGGAAGCTGAGACACGAGG + Intergenic
1135873124 16:26170464-26170486 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1136023322 16:27453997-27454019 ACTCAGGAGGCTGAGACACGAGG + Intergenic
1136026731 16:27473532-27473554 ACAGAGGAGGCTGAGGCACATGG + Intronic
1136058463 16:27708123-27708145 ACGCAGGAGGCTGAGGCAGGAGG - Intronic
1136137479 16:28265477-28265499 TGGGAGGAGGCTAAGGCAGGAGG + Intergenic
1136334318 16:29601550-29601572 AGGCAGGAGGCTGAGGCAGGGGG - Intergenic
1136360593 16:29776981-29777003 AGTCAGGAGGCTGAGGCAAGAGG - Intergenic
1136364307 16:29802156-29802178 ACTCAGGAGGCTGAGACAGGGGG + Intronic
1136471360 16:30482933-30482955 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1137235992 16:46618748-46618770 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1137377937 16:47970271-47970293 TAGGAAGAGGCTGAGACACTTGG - Intergenic
1137513126 16:49118777-49118799 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
1137608022 16:49799896-49799918 ACGCAGGAGGCTGAGGCAGGAGG - Intronic
1137831491 16:51547674-51547696 AAGGAGGAGGGTGAGAGATGTGG + Intergenic
1137978299 16:53049262-53049284 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1137985966 16:53108394-53108416 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1138088055 16:54151977-54151999 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1138198817 16:55073998-55074020 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1138420648 16:56896981-56897003 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1138468172 16:57209605-57209627 TGGGAGGAGGCCGAGGCAGGTGG - Intronic
1138568322 16:57850292-57850314 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1138770600 16:59658306-59658328 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1139042070 16:63009953-63009975 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1139120119 16:64006014-64006036 ACTCAGGAGGCTGAGACAAGAGG - Intergenic
1139426355 16:66882325-66882347 ATGTAGGAGGCTGAGGCAGGAGG + Intronic
1139834823 16:69829897-69829919 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1140056541 16:71530656-71530678 ACTGGGGAGGCTGAGACAGGAGG + Intronic
1140328212 16:74026677-74026699 AGGAAGGAGGCTGAGCCAGCAGG + Intergenic
1140390130 16:74579304-74579326 GTGGTGGAGGCTGAGACAGGAGG + Intronic
1140407797 16:74722425-74722447 ACTGAGGAGGCTGAGGCAGGGGG + Intronic
1140446496 16:75032902-75032924 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1140822714 16:78678265-78678287 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1140978597 16:80084585-80084607 CAGGAGGAGCCTGAGACAGGAGG - Intergenic
1140988643 16:80186139-80186161 ATTAAGGAGGCTGAGACAGGAGG - Intergenic
1141020037 16:80486547-80486569 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1141128894 16:81421122-81421144 ACGTAGGAGGCTCAGACAGGAGG - Intergenic
1141482037 16:84313170-84313192 AGGGAGGGGGCTGAGGGAGGAGG + Intronic
1141570643 16:84931629-84931651 AGAGAGGAGGCAGAGGCCCGGGG - Intergenic
1141589783 16:85060733-85060755 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1141612328 16:85188690-85188712 ACGGGGGAGGCTGAGGCAGGAGG + Intergenic
1141655668 16:85415051-85415073 AGTCAGGAGGCTGAGGCAAGAGG - Intergenic
1141740468 16:85888592-85888614 ACTCAGGAGGCTGAGACAAGAGG - Intergenic
1141899798 16:86983751-86983773 TGGGAGGAGGCTGAGAGTGGAGG + Intergenic
1142612500 17:1116893-1116915 GGGGCGGAGGCTGAAACTCGAGG + Intronic
1142679644 17:1539251-1539273 AGGCAGGAGGCTGAGGCAGGAGG - Intronic
1142679655 17:1539287-1539309 AGGCAGGAGGCTGAGACAGTAGG - Intronic
1142679696 17:1539483-1539505 AGGCAGGAGACTGAGAGAGGAGG - Intronic
1142725442 17:1810523-1810545 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1142879411 17:2872790-2872812 TGTGAGGAGGCTGAGGCAGGAGG - Intronic
1143206164 17:5140462-5140484 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1143550797 17:7629267-7629289 ACTAAGGAGGCTGAGACAGGAGG + Intronic
1144111015 17:12032942-12032964 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1144122435 17:12168089-12168111 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1144526723 17:15996740-15996762 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1144576174 17:16431158-16431180 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1144643725 17:16954273-16954295 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1144811256 17:18001006-18001028 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1145068202 17:19778696-19778718 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1145224074 17:21113109-21113131 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1146117606 17:30155650-30155672 AGCCAGGAGGCTGAGGCAAGAGG - Intronic
1146287442 17:31583455-31583477 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1146330028 17:31919108-31919130 ACCCAGGAGGCTGAGACAGGAGG - Intergenic
1146543901 17:33721628-33721650 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1146563880 17:33895269-33895291 ACTCAGGAGGCTGAGACACGAGG - Intronic
1146744814 17:35319181-35319203 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1146842446 17:36165366-36165388 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1146854756 17:36253325-36253347 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1146865864 17:36335051-36335073 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1146870656 17:36377217-36377239 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1146878014 17:36428298-36428320 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1146881955 17:36449402-36449424 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1146923249 17:36727707-36727729 AGGCAGGAGGCTCAGCCACTGGG - Intergenic
1146940080 17:36838395-36838417 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1147068734 17:37935663-37935685 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1147073539 17:37977841-37977863 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1147080257 17:38015200-38015222 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1147085061 17:38057379-38057401 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1147096205 17:38139160-38139182 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1147101007 17:38181345-38181367 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1147176897 17:38661474-38661496 ACTCAGGAGGCTGAGACAAGAGG - Intergenic
1147285845 17:39402008-39402030 AGGGAGGAGAGGGGGACACGGGG - Intronic
1147474604 17:40698815-40698837 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1147567230 17:41545292-41545314 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1147568846 17:41554625-41554647 AGGGAGGAGGATGACAGAGGAGG - Intergenic
1147647513 17:42042773-42042795 AGGGAGGACACTGAGCCACCTGG - Intronic
1147953726 17:44121149-44121171 AGGGAGGAGGCGGAGGCAGAGGG + Intronic
1148116609 17:45178971-45178993 ACGCAGGAGGCTGAGGCAGGAGG + Intergenic
1148541254 17:48482398-48482420 ACTCAGGAGGCTGAGTCACGAGG + Intergenic
1148872508 17:50667110-50667132 AGTCAGGAGGCTGAGACAGGAGG + Intronic
1149261208 17:54881811-54881833 ACTCAGGAGGCTGAGACACAAGG - Intergenic
1149588078 17:57806957-57806979 ACGGGGGAGGCTGACACAGGAGG - Intergenic
1149604335 17:57914292-57914314 AGAGAGAAGCCTGAGACACAGGG + Intronic
1149688365 17:58552420-58552442 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1149692793 17:58591948-58591970 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1149845598 17:60007808-60007830 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1149876773 17:60242231-60242253 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1149888701 17:60366655-60366677 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1150083947 17:62264391-62264413 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1150113344 17:62521511-62521533 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1150128529 17:62653746-62653768 AGGGAGGAGGGTGTGAAAAGGGG + Intronic
1150230521 17:63547289-63547311 TGGGAGGAGGATGAGGCAGGAGG + Intronic
1150238890 17:63616100-63616122 ACTGAGGAGACTGAGACAGGAGG + Intergenic
1150331689 17:64299346-64299368 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1150715619 17:67570310-67570332 AGGATGGAGCCTGGGACACGTGG + Intronic
1150738745 17:67762484-67762506 AGGGTGGAGGCCGAGGCAGGAGG - Intergenic
1150806206 17:68321059-68321081 ACCCAGGAGGCTGAGACAGGAGG + Intronic
1150915145 17:69429192-69429214 AGGCTGGAGGCTGAGACAGAAGG + Intronic
1151460282 17:74250145-74250167 AGGGAGGGAGCCGAGTCACGGGG - Intronic
1151487518 17:74410560-74410582 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1151531896 17:74712011-74712033 AGGCTGGAGGCTGAGGCATGAGG - Intronic
1151616578 17:75216992-75217014 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1151677410 17:75605782-75605804 AGGGAGGAGGCTGAGACCAGAGG + Intergenic
1151761875 17:76108916-76108938 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1151856320 17:76724706-76724728 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1151859180 17:76747016-76747038 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1151939583 17:77284095-77284117 ACTCAGGAGGCTGAGACACGAGG + Intronic
1151939590 17:77284139-77284161 ACTCAGGAGGCTGAGACACGAGG + Intronic
1151939598 17:77284183-77284205 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1152558578 17:81066823-81066845 CAGGAGGAGGCTGGGACACATGG - Intronic
1152717610 17:81907441-81907463 AGGGAGGAGGGTGAGGCTCTGGG + Intronic
1152779798 17:82221793-82221815 AGGCAGGAGGCGGAGGCAGGAGG + Intergenic
1152792488 17:82288972-82288994 TGAGAGGAGCCTGAGACCCGAGG + Intergenic
1153571727 18:6480098-6480120 ACTGAGGAGGCTGAGACAGGAGG + Intergenic
1153721108 18:7904412-7904434 ATGGAGGAAGATGAGACAGGAGG - Intronic
1153835392 18:8959336-8959358 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1154284331 18:13037662-13037684 ACACAGGAGGCTGAGACAGGAGG - Intronic
1154356980 18:13628937-13628959 ACGCAGGAGGCTGAGGCAGGGGG - Intronic
1154532898 18:15365440-15365462 GGAGAGGAGGCTGAGGCAGGAGG + Intergenic
1155352494 18:24920118-24920140 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1155523764 18:26695806-26695828 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1155529370 18:26750632-26750654 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1155741052 18:29288325-29288347 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1155756142 18:29498870-29498892 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1155774232 18:29738156-29738178 AGGGAGGCTGCTTAGACAGGTGG - Intergenic
1155863924 18:30940740-30940762 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
1156335300 18:36166082-36166104 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1156454777 18:37286829-37286851 ATGGAGGAGGCTGGGCCAGGTGG - Intronic
1157047343 18:44118254-44118276 AGTTGGGAGGCTGAGACAGGAGG - Intergenic
1157140665 18:45103062-45103084 AGGGAGGAAGTTGAGATAGGAGG - Intergenic
1157313712 18:46571359-46571381 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1157488825 18:48108162-48108184 AGGGAGGAAACTGAGACTCATGG + Intronic
1157562681 18:48659807-48659829 AGTCAGGAGGCTGAGCCACAGGG + Intronic
1157764496 18:50286475-50286497 AGGGAGGAGGAGGAGCCACAAGG - Intronic
1157765286 18:50291913-50291935 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
1158207669 18:55011471-55011493 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1158228083 18:55221155-55221177 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1158696299 18:59707165-59707187 AGTTAGGAGGCTGAGGCAGGAGG - Intergenic
1158818261 18:61129087-61129109 AGTGAGGAGGCTAACACAGGTGG + Intergenic
1159342547 18:67154941-67154963 AGGAAGGAGGGTGAGAGACTGGG + Intergenic
1159449025 18:68576345-68576367 ACTGAGCAGGCTGAGACAGGAGG + Intergenic
1160257525 18:77259810-77259832 AGGGAGGTGGCGGAGAGAGGGGG + Intronic
1160448573 18:78946811-78946833 AGGGAGGAGGAGGAGAGAGGAGG + Intergenic
1160536602 18:79597835-79597857 GGGGATGAGGGTGAGACCCGAGG + Intergenic
1160605272 18:80045333-80045355 ACGCAGGAGGCTGAGGCAGGAGG - Intronic
1160629370 18:80234666-80234688 GGGAGGGAGGCTGAGACAGGAGG + Intronic
1160683175 19:421799-421821 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1160987425 19:1845553-1845575 AGTCAGGAGGCTGAGCCAGGTGG + Intronic
1161096527 19:2395322-2395344 AGGCAGGAGGCTGAGGCAGGAGG + Intronic
1161190849 19:2954581-2954603 GGGGAGGAGGCTGAGGCGGGCGG + Intergenic
1161376696 19:3942794-3942816 ACACAGGAGGCTGAGACAGGAGG + Intergenic
1161403728 19:4080690-4080712 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1161492716 19:4571163-4571185 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
1161511915 19:4676702-4676724 AGGGAGGAGCCTAGGACACGGGG - Intronic
1161556866 19:4947993-4948015 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1161694091 19:5755870-5755892 AGGCAGGAGGCTGAGGCAGGAGG + Intronic
1161720946 19:5902370-5902392 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1161727164 19:5936210-5936232 GGGGAGGAGGCTCAGCCATGCGG + Intronic
1161798291 19:6400519-6400541 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1161846686 19:6715365-6715387 ACCCAGGAGGCTGAGACAGGAGG + Intronic
1161972272 19:7589174-7589196 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1162072475 19:8162354-8162376 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1162311902 19:9913091-9913113 CGGGAGGAGGGTGAGACTCGGGG - Intronic
1162448626 19:10740482-10740504 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1162550155 19:11354279-11354301 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1162559083 19:11405625-11405647 AGGCAGGAGGCTGAGGCATGTGG - Intronic
1162591912 19:11597595-11597617 AGGGAGGACGCCGGGACACCTGG + Exonic
1162623841 19:11866916-11866938 ACTCAGGAGGCTGAGACATGAGG + Intronic
1162635264 19:11963196-11963218 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1162660240 19:12163171-12163193 AGGGAGGAAGCTGGGACACCCGG + Exonic
1162733495 19:12733010-12733032 ACCCAGGAGGCTGAGACAGGAGG - Intronic
1162799271 19:13102078-13102100 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1162840537 19:13353225-13353247 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1162852725 19:13443448-13443470 AATGAGGAGGCTGAGGCAGGAGG - Intronic
1162855774 19:13467370-13467392 ACTGGGGAGGCTGAGGCACGAGG + Intronic
1162864148 19:13531421-13531443 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
1163024755 19:14504294-14504316 TGGGAGGAGGCTGAAGCAGGAGG - Intergenic
1163046134 19:14643817-14643839 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1163114818 19:15182396-15182418 AGTGGGGAGGCTGAGACGGGAGG + Intronic
1163167589 19:15508561-15508583 GGGCAGGAGGCTGAGACCCGCGG + Exonic
1163169903 19:15523949-15523971 ACCCAGGAGGCTGAGACAGGAGG + Intronic
1163236787 19:16034511-16034533 TGGGAGGAGGCTCAGACAGCAGG + Intergenic
1163303098 19:16460178-16460200 ACTAAGGAGGCTGAGACAGGAGG + Intronic
1163413025 19:17168686-17168708 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1163416259 19:17188318-17188340 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1163422923 19:17225065-17225087 AGACAGGAGGCTGAGGCAGGAGG + Intergenic
1163474014 19:17514598-17514620 ACTGAGGAGGCTGAGGCAGGGGG - Intronic
1163565168 19:18046763-18046785 AGGGAGGAAACTGAGACTCTGGG + Intergenic
1163680775 19:18681086-18681108 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1163781134 19:19249177-19249199 ACTCAGGAGGCTGAGACACAAGG - Intronic
1163832932 19:19555802-19555824 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1163846556 19:19641627-19641649 AGGGTGGAGGCTGAGGTAGGAGG - Intronic
1164166691 19:22684418-22684440 ATGTGGGAGGCTGAGACAAGAGG - Intergenic
1164484930 19:28647204-28647226 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
1164578695 19:29421076-29421098 GGAGAGGAGGCTGGGACAGGTGG - Intergenic
1164726009 19:30466112-30466134 AGGGAGGAGGCTGAGGTGGGAGG + Intronic
1164775875 19:30853165-30853187 AGAGAGGCGGTTGAGAGACGGGG - Intergenic
1164783285 19:30910454-30910476 AGGGCTGAGCCTGAGAGACGTGG + Intergenic
1164990588 19:32679806-32679828 AGACAGGAGGCTGAGACAGGAGG - Intergenic
1165039227 19:33057232-33057254 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1165079006 19:33297186-33297208 GAGTAGGAGGCTGAGGCACGAGG + Intergenic
1165126995 19:33605176-33605198 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1165305340 19:34999971-34999993 AGGGAGGAACCTGAGAGCCGGGG - Intronic
1165307389 19:35010991-35011013 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1165410252 19:35655700-35655722 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1165651570 19:37495507-37495529 TGGGAGGAGGCCGAGGCAGGTGG - Intergenic
1165707232 19:37985417-37985439 ACCGGGGAGGCTGAGACAGGAGG + Intronic
1165812048 19:38617712-38617734 AGGGAGGAGGCTGCAAGAGGGGG - Intronic
1165894475 19:39133453-39133475 AGGGAGGAGACTGAGAGCCTGGG + Intronic
1166068186 19:40372386-40372408 ACGCAGGAGGCTGAGGCAGGGGG + Intronic
1166081184 19:40444740-40444762 AGGGAGGACGCTGGGGCGCGGGG + Intergenic
1166247870 19:41543200-41543222 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1166537628 19:43584953-43584975 ATGGGGGAGGCTGAGGCAAGTGG - Exonic
1166692335 19:44830409-44830431 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1166693431 19:44838402-44838424 ACTCAGGAGGCTGAGACACAAGG + Intergenic
1166751614 19:45166562-45166584 AGGGAGGAGGCCCAGACTGGGGG + Intronic
1166788573 19:45384186-45384208 CAGGAGGAGGCTGAGGCAGGAGG - Intronic
1166927876 19:46281531-46281553 ACGGAGGAGGCTGAGGTAAGAGG + Intergenic
1166935421 19:46329538-46329560 AGGGATGAGGCTGAAGCAGGAGG - Intronic
1166985687 19:46659185-46659207 AGGGAGGAGGCGGTGGCAGGCGG - Intronic
1167001931 19:46750632-46750654 AGGAGGGAGGCTGAGGCAGGAGG - Intronic
1167004918 19:46769386-46769408 ACCGAGGAGGCTGAGGCAGGAGG + Intronic
1167045726 19:47047735-47047757 AAGCAGGAGGCTGAGGCAAGAGG + Intronic
1167094113 19:47364627-47364649 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
1167139207 19:47638073-47638095 AGGAGGGAGGCAGAGACCCGTGG - Intronic
1167144508 19:47673642-47673664 AGGGAGGGGGTTGAGACAGAGGG - Intronic
1167147087 19:47688179-47688201 AGGAGGGAGGCTGAGGCAGGAGG + Intronic
1167206535 19:48106189-48106211 ACTTAGGAGGCTGAGACATGAGG - Intronic
1167257604 19:48440482-48440504 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1167271007 19:48506195-48506217 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
1167278172 19:48551503-48551525 AGGGCGGAGACAGAGACACACGG - Intergenic
1167397694 19:49242376-49242398 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1167564508 19:50247949-50247971 ACTTGGGAGGCTGAGACACGAGG + Intronic
1167569923 19:50280565-50280587 AGGGATGAGGCTGAGAGTCAGGG - Intronic
1167674021 19:50873587-50873609 AGGGACGAGGCTGGGGCACTGGG - Intronic
1167741657 19:51327657-51327679 ACGGAGGAGCCTGAGAGTCGGGG + Intronic
1167758521 19:51428161-51428183 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1167936052 19:52909489-52909511 ATTTAGGAGGCTGAGACATGTGG - Intergenic
1168007183 19:53499882-53499904 ACTGAGGAGGCTGAGGTACGAGG + Intergenic
1168017070 19:53582126-53582148 AGGGAGAATACTGAGAAACGAGG + Intergenic
1168021512 19:53612272-53612294 AGTTAGGAGGCTGAGACAGGAGG + Intergenic
1168097696 19:54124868-54124890 GGGGAGGAGACTGAGGCACAGGG - Intronic
1168180294 19:54657938-54657960 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1168212626 19:54901575-54901597 AGGTGGGAGGCTGAGGCAGGCGG + Intergenic
1168259075 19:55182901-55182923 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1168276551 19:55281847-55281869 AGGCAGGAGGCTGAGGCAGGAGG + Intergenic
1168295633 19:55376300-55376322 TGGGAGGGGGATGAGACAAGGGG - Intergenic
1168404476 19:56103545-56103567 AGTGAGGAAGCTGAGGCGCGAGG - Intronic
1168409197 19:56128113-56128135 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1168572061 19:57479299-57479321 AGCCAGGAGGCTGAGAAAAGAGG - Intergenic
1168684001 19:58336961-58336983 AGGGAGGAGGCAGAGACAGGTGG - Intronic
925165305 2:1711888-1711910 AGGCAGGAGGCTGACCCAGGAGG + Intronic
925172581 2:1759444-1759466 GGGGAGGCGGCTGAGGCCCGGGG + Intergenic
925371653 2:3349680-3349702 AGGGAGGACGCTGTGAGATGGGG + Intronic
925946517 2:8869153-8869175 ACTCAGGAGGCTGAGACAGGAGG - Intronic
925972225 2:9113635-9113657 AGGCTGGAGGCTGAGCCTCGGGG - Intergenic
925992125 2:9262090-9262112 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
926010088 2:9400406-9400428 AGGGAGGAGGGTGAGAGGAGGGG - Intronic
926146117 2:10398026-10398048 AGGGAGGAGGGAGAGAGAGGAGG - Intronic
926173800 2:10571163-10571185 AGGGAGGTGACTGAAACATGGGG + Intronic
926266842 2:11330892-11330914 AGGGAGGAGGAAGAGAGAGGAGG + Intronic
926452571 2:13023840-13023862 AGGCAGGAGGCTGAGGCAGGAGG - Intergenic
926573181 2:14552158-14552180 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
926652573 2:15362397-15362419 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
926899826 2:17738759-17738781 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
927041251 2:19232611-19232633 ACTCAGGAGGCTGAGACATGAGG + Intergenic
927110141 2:19858776-19858798 AGGGCAGAAGCGGAGACACGGGG + Intergenic
927224665 2:20751998-20752020 ACTTAGGAGGCTGAGACAGGAGG - Intronic
927422417 2:22947485-22947507 GGGGAGGAGGCTGGGAGAGGAGG + Intergenic
927491116 2:23521555-23521577 AGGGAGGAGGCAGAGAGGAGTGG - Intronic
927547137 2:23964021-23964043 ACTGAGGAGGCTGAGACAGGAGG + Intronic
927647569 2:24887608-24887630 GGGGAGTGGGCTGGGACACGTGG - Intronic
927655970 2:24946751-24946773 ACTCAGGAGGCTGAGACAGGAGG - Exonic
927709155 2:25314421-25314443 AGGGAGGAGGCGGAGGCAGCTGG - Intronic
927716560 2:25356989-25357011 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
927731646 2:25478641-25478663 AGAGAGGAGGCTGAGGTAGGAGG - Intronic
927735859 2:25521490-25521512 ACTCAGGAGGCTGAGGCACGAGG - Intronic
928029265 2:27764998-27765020 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
928553649 2:32399499-32399521 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
928566793 2:32560810-32560832 ACTCAGGAGGCTGAGACAAGAGG - Intronic
928841563 2:35611701-35611723 AAGGAGGAGGTGGAGACCCGGGG + Intergenic
928994509 2:37272872-37272894 ACTCAGGAGGCTGAGACAGGAGG + Intronic
929146864 2:38713794-38713816 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
929149939 2:38738462-38738484 ACTCAGGAGGCTGAGACAGGAGG + Intronic
929163039 2:38852721-38852743 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
930139063 2:47933311-47933333 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
930535802 2:52644706-52644728 AGGAAGAAGGCTGAGAAACCTGG - Intergenic
930690542 2:54358636-54358658 TGGGAGGAGGCCAAGACAGGAGG - Intronic
930771076 2:55131315-55131337 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
930796793 2:55401323-55401345 ACGCAGGAGGCTAAGACAGGAGG + Intronic
931277575 2:60756860-60756882 AGGGAGGAGGGGGAGGCAGGGGG - Intronic
931348356 2:61467391-61467413 CGGCAGGAGGCTGAGGCAGGAGG - Intronic
931726998 2:65121123-65121145 ACTCAGGAGGCTGAGACAGGAGG + Intronic
931740411 2:65237605-65237627 ACTCAGGAGGCTGAGACAGGAGG + Intronic
931955908 2:67424539-67424561 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
932006116 2:67928691-67928713 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
932147408 2:69335113-69335135 ACTCAGGAGGCTGAGGCACGAGG - Intronic
932380220 2:71275890-71275912 AGGCAGGAGGCTGAGGCGGGAGG - Intergenic
932389628 2:71374811-71374833 CAGGAGGAGGCTGAGGCAGGAGG + Intronic
932455642 2:71848129-71848151 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
932458957 2:71870007-71870029 AGGGATGAGGGTGAGAGAGGAGG - Intergenic
932631241 2:73345142-73345164 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
932639995 2:73435698-73435720 ACAGAGGAGGCTGAGGCAGGAGG - Intronic
932647343 2:73517360-73517382 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
932698491 2:73976970-73976992 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
932727431 2:74191569-74191591 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
932762203 2:74445652-74445674 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
933241313 2:79923736-79923758 AGCGAGGGGGATGAAACACGGGG - Intronic
933631128 2:84659871-84659893 ACGTAGGAGGCTGAGGCAAGAGG + Intronic
933680461 2:85095361-85095383 AGGTGGGAGGCTGAGGCAGGAGG - Intergenic
933885177 2:86712531-86712553 ATGCAGGAGGCTGAGGCAGGAGG - Intronic
933924997 2:87084153-87084175 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
934161819 2:89257008-89257030 ACTGGGGAGGCTGAGACAAGAGG - Intergenic
934205463 2:89925354-89925376 ACTGGGGAGGCTGAGACAAGAGG + Intergenic
934504848 2:94881643-94881665 TGGGGGGAGGCTGAGGCAAGAGG - Intergenic
934558590 2:95300559-95300581 AGGCAGGAGCCTGAGAGTCGGGG + Intronic
934712183 2:96523426-96523448 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
934748852 2:96778693-96778715 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
935963923 2:108453674-108453696 ACTCAGGAGGCTGAGGCACGAGG + Intronic
936370381 2:111898331-111898353 GGGGAGGGGGCTGAGAGACCCGG - Intergenic
936971359 2:118179223-118179245 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
937123501 2:119457602-119457624 AGTTAGGAGGCTGAGCCAGGAGG + Intronic
937270295 2:120645822-120645844 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
937329061 2:121012378-121012400 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
937623079 2:124012198-124012220 ATGTGGGAGGCTGAGACACGAGG - Intergenic
938060096 2:128247447-128247469 ACTCAGGAGGCTGAGGCACGAGG - Intronic
938070739 2:128306915-128306937 TGGGGGGAGGCTGAGGCACAGGG + Intronic
938193081 2:129300454-129300476 AGGGAGGAGGTTGAGCTATGAGG + Intergenic
938343031 2:130548044-130548066 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
938346802 2:130572678-130572700 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
938414528 2:131093340-131093362 CGGGAGGCGGCGGAGACGCGGGG - Exonic
938423153 2:131160413-131160435 ACTCAGGAGGCTGAGACAGGAGG - Intronic
938531999 2:132196693-132196715 GGAGAGGAGGCTGAGGCAGGAGG + Intronic
938639126 2:133261963-133261985 AGGGAGGAGGTTGAGAGACGAGG + Intronic
938774440 2:134529220-134529242 ACTCAGGAGGCTGAGACAGGAGG + Intronic
938795611 2:134716591-134716613 AGGCAGGATGCAGAGACACACGG + Intronic
938885058 2:135637537-135637559 ACTCAGGAGGCTGAGACAGGAGG + Intronic
940350159 2:152675751-152675773 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
940654244 2:156469269-156469291 ACTCAGGAGGCTGAGACAGGAGG - Intronic
941404513 2:165071740-165071762 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
941681500 2:168404274-168404296 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
941686180 2:168451362-168451384 GGGAAGGAGGCTGAGGCAGGAGG + Intergenic
941728085 2:168886160-168886182 ACTCAGGAGGCTGAGACAGGAGG - Intronic
941901799 2:170686171-170686193 ATTTAGGAGGCTGAGACAGGAGG + Intergenic
941908381 2:170738704-170738726 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
941938123 2:171002742-171002764 ACACAGGAGGCTGAGACAAGAGG - Intronic
942007601 2:171721041-171721063 ACTCAGGAGGCTGAGACAGGAGG + Intronic
942020340 2:171861513-171861535 ACTCAGGAGGCTGAGACAGGAGG - Intronic
942386280 2:175446849-175446871 ACACAGGAGGCTGAGACATGAGG - Intergenic
942465357 2:176202316-176202338 AGGAAGGAGGCTGAGATGAGAGG - Intergenic
942651425 2:178172785-178172807 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
943062862 2:183056841-183056863 ACTCAGGAGGCTGAGACATGAGG + Intergenic
943265141 2:185720871-185720893 ATCCAGGAGGCTGAGACAGGAGG - Intergenic
943443306 2:187951927-187951949 AGGGAGGCGGCTGAGGCCCGGGG - Intergenic
943601941 2:189931607-189931629 AGGAGGGAGGCTGAGGCAGGAGG - Intronic
943747894 2:191481221-191481243 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
943755019 2:191548666-191548688 AGACGGGAGGCTGAGACAGGAGG - Intergenic
944079478 2:195770821-195770843 ACTCAGGAGGCTGAGACAGGAGG - Intronic
944219303 2:197286481-197286503 ACTGGGGAGGCTGAGACAGGAGG - Intronic
944464055 2:199982706-199982728 AAGGAGGAGCCTGAGAGAGGGGG - Intronic
944714221 2:202362628-202362650 TGGGAGGAGGCCGAGGCAGGCGG - Intergenic
944741016 2:202612775-202612797 ACGTAGGAGGCTGAGGCAGGAGG + Intergenic
945168948 2:206975965-206975987 AGGCAGGAGGCTAGGACAAGGGG + Intergenic
945297625 2:208186739-208186761 AGGCAGGATGCTGAAACACTTGG - Intronic
945728388 2:213502232-213502254 ACGGGGGAGGCTGAGACAGGAGG - Intronic
945845788 2:214943244-214943266 ATTCAGGAGGCTGAGACAGGAGG - Intronic
945975843 2:216270182-216270204 ACTCAGGAGGCTGAGACAGGAGG - Intronic
946189992 2:218003060-218003082 AGAGAGGAGGCTGGGACGAGGGG - Intergenic
946234272 2:218313217-218313239 ACTCAGGAGGCTGAGACAGGAGG - Intronic
946243072 2:218368487-218368509 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
946307932 2:218866400-218866422 ATGGAGGAGGAGGAGACACAGGG + Intronic
946354042 2:219173749-219173771 ACTCAGGAGGCTGAGACAAGAGG - Intronic
946942990 2:224789629-224789651 ACTTAGGAGGCTGAGACAGGAGG + Intronic
947202277 2:227624873-227624895 AGTTGGGAGGCTGAGACAGGAGG - Intronic
947352881 2:229264623-229264645 AGTGAGGAGACAGAGACAAGTGG + Intronic
947439908 2:230110030-230110052 ACTCAGGGGGCTGAGACACGAGG + Intergenic
947442270 2:230133656-230133678 AGGGAGGATGCAGAGCCACAGGG - Intergenic
947537181 2:230947610-230947632 ACGTGGGAGGCTGAGGCACGAGG - Intronic
947538731 2:230959337-230959359 ACTCAGGAGGCTGAGACAAGAGG + Intronic
947600034 2:231441511-231441533 GGGGAGGAGGCCGAGGCAGGAGG - Intergenic
947609747 2:231516972-231516994 ACACAGGAGGCTGAGACAGGAGG + Intergenic
947613584 2:231539586-231539608 GCTGAGGAGGCTGAGACAGGAGG + Intergenic
947625479 2:231615643-231615665 GGGGAGGCGGCCGAGACACAGGG - Intergenic
947767710 2:232648131-232648153 AGGCAGGAGGCTGAGGCGTGAGG + Intronic
948131849 2:235606838-235606860 ACTGAGGAGGCTGAGGCAGGGGG + Intronic
948213085 2:236209379-236209401 ACTCAGGAGGCTGAGACAGGAGG - Intronic
948364918 2:237448560-237448582 AAGGAGGGTGCTGAGACAAGGGG + Intergenic
948466036 2:238152075-238152097 AGGGCGGAGCCTGTGACAGGAGG - Exonic
948804838 2:240449002-240449024 AGGGAGAAGTCTGAGACCTGGGG + Intronic
948836526 2:240628693-240628715 AGGGAGGAGGCAGAGGGAGGAGG + Intronic
948864582 2:240768812-240768834 AGGCTGGAGACTGAGACACGAGG - Intronic
948877538 2:240837627-240837649 AGGGAGGGGGCTGATACTCCTGG + Intergenic
948944113 2:241210786-241210808 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1168745558 20:236765-236787 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1168897257 20:1332197-1332219 TCGTAGGAGGCTGAGACAGGAGG - Intronic
1169158833 20:3358525-3358547 TGTGAGGAGGCTGAGGCAGGTGG - Intronic
1169260368 20:4134066-4134088 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1169313266 20:4566298-4566320 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1169855283 20:10095209-10095231 AGGGAGCAGGCTAAGATAGGAGG + Intergenic
1170007642 20:11686540-11686562 AGGGAGGAGGCAGGAACTCGAGG - Intergenic
1170230177 20:14037773-14037795 TGGGAGGAGGCTGAGGCGGGTGG + Intronic
1170554342 20:17503681-17503703 AGGGAGGAGGCTGAGGTGCAGGG - Intronic
1170957717 20:20996545-20996567 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1170979828 20:21201068-21201090 AGTTAGGAGGCTGAGGCAGGAGG + Intronic
1171003483 20:21439189-21439211 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
1171272245 20:23826182-23826204 AGGGAGGAGGGTGAGCCTCATGG + Intronic
1171538589 20:25923343-25923365 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1171570770 20:26249334-26249356 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1171860441 20:30397071-30397093 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1172217029 20:33243009-33243031 CAGGAGGAGGCTGAGACCCTGGG - Intronic
1172305832 20:33880069-33880091 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1172372541 20:34406128-34406150 TGGGGGGAGGCTGAGGCAGGAGG - Intronic
1172378827 20:34470699-34470721 AGCGAGAAGGCTGAGGCAAGAGG - Intronic
1172392706 20:34576728-34576750 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1172405269 20:34683831-34683853 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1172438505 20:34948065-34948087 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1172446869 20:34997775-34997797 TGGTAGGAGGCTGAGAAATGAGG - Intronic
1172464250 20:35144015-35144037 AGGGAGGAGGGTGAGGTAGGAGG - Intronic
1172508771 20:35484690-35484712 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1172564298 20:35916868-35916890 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1172645157 20:36464451-36464473 TTGGAGGAGGCTGAGGCAGGAGG + Intronic
1172672666 20:36645094-36645116 ATTTAGGAGGCTGAGACAGGAGG + Intronic
1172690792 20:36788239-36788261 ATGTGGGAGGCTGAGACAGGAGG + Intronic
1172697060 20:36830225-36830247 AGGGAGGAGACTGAGGAACTGGG + Intronic
1172805386 20:37608223-37608245 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1172915992 20:38444221-38444243 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1173037543 20:39427232-39427254 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1173248320 20:41351142-41351164 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1173265116 20:41472123-41472145 ACGCAGGAGGCTGAGGCAAGAGG + Intronic
1173401028 20:42726186-42726208 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1173685031 20:44917289-44917311 ACAAAGGAGGCTGAGACAGGAGG - Intronic
1173843904 20:46176247-46176269 AGGCTGGAGGCTGAGATATGGGG - Intronic
1173864215 20:46303937-46303959 AGGGAGGAGGCTGCCACAACAGG + Intronic
1174104805 20:48154602-48154624 AGGGAGGAGGCAGAGCCCAGAGG + Intergenic
1174210545 20:48874766-48874788 ACGGGGGAGGCTGAGGCAGGAGG + Intergenic
1174228876 20:49027585-49027607 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
1174263594 20:49315365-49315387 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1174705795 20:52654764-52654786 AGGGAGGAGGCTGCCACACCAGG + Intergenic
1174792835 20:53496452-53496474 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1174917399 20:54668159-54668181 GGGGAGGAGCCTGAGGCTCGGGG + Intergenic
1175269926 20:57726513-57726535 ACTGGGGAGGCTGAGACAGGAGG + Intergenic
1175492163 20:59386630-59386652 AGGGGGGAAACTGAGACACCAGG + Intergenic
1175882121 20:62266011-62266033 ACTGGGGAGGCTGAGACAGGAGG + Intronic
1176049798 20:63112742-63112764 AGGGAGAGAACTGAGACACGTGG + Intergenic
1176089871 20:63313998-63314020 AGGGAGGCAGCTGAGCCGCGTGG + Intronic
1176301686 21:5101703-5101725 AGGGAGGGGGCAGGGATACGAGG + Intergenic
1176764460 21:13002758-13002780 GGAGAGGAGGCTGAGGCAGGAGG - Intergenic
1176995633 21:15552270-15552292 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1177270845 21:18847928-18847950 ACTCAGGAGGCTGAGACAGGGGG + Intergenic
1178218972 21:30633606-30633628 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1178374874 21:32058426-32058448 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1178419931 21:32435295-32435317 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1178424266 21:32466902-32466924 GGGTGGGAGGCTGAGACAGGAGG - Intronic
1178451671 21:32707393-32707415 AGGAAGGAGGCTGAGGCAGGAGG - Intronic
1178558368 21:33614378-33614400 ATTGAGGAGGCTGAGGCAGGAGG + Intronic
1178600806 21:33992956-33992978 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1178712085 21:34926359-34926381 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1178824629 21:36004958-36004980 AGGGGGGAGGGGGAGACAGGGGG + Intergenic
1178824645 21:36004991-36005013 AGGGAGGAGGGGGAGGCAGGGGG + Intergenic
1178843144 21:36154533-36154555 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
1179177465 21:39019343-39019365 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1179209045 21:39310516-39310538 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1179216944 21:39375650-39375672 ACTCAGGTGGCTGAGACACGAGG - Intergenic
1179269572 21:39840391-39840413 TGAGAGGAGGCTGTCACACGTGG + Intergenic
1179354456 21:40646057-40646079 AGGGAGCAGGCTGTGAAACTAGG + Intronic
1179855345 21:44160196-44160218 AGGGAGGGGGCAGGGATACGAGG - Intergenic
1180031798 21:45215154-45215176 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1180174315 21:46080323-46080345 AGGGAGGAGGGGGGGACGCGAGG - Intergenic
1180182664 21:46124852-46124874 AAGGATGAGGCTGAGACTCTGGG - Intronic
1180228032 21:46409295-46409317 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1180511656 22:16097581-16097603 GGAGAGGAGGCTGAGGCAGGAGG - Intergenic
1180572930 22:16746350-16746372 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1180845116 22:18976579-18976601 AGGGAAGAGGCTGAGACTCTGGG - Intergenic
1180929341 22:19578408-19578430 AGCCAGGAGGCTGAGGCAGGAGG + Intergenic
1180943469 22:19675985-19676007 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1181056350 22:20262165-20262187 AGGGAAGAGGCTGAGACTCTGGG + Intronic
1181147786 22:20860926-20860948 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1181170309 22:21004888-21004910 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1181180566 22:21065238-21065260 AGGGAGAAGGCTGAGTGAGGTGG - Intergenic
1181185003 22:21096823-21096845 AGGTGGGAGGCTGAGGCAGGCGG + Intergenic
1181382866 22:22520844-22520866 AGGGAGGAGGGAGAGACAGAGGG - Intergenic
1181590240 22:23879733-23879755 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1181765431 22:25088214-25088236 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1181784160 22:25214227-25214249 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1181887339 22:26031737-26031759 AGGGAGGAGGATGGGGCAGGAGG + Intergenic
1182251934 22:29007531-29007553 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1182605396 22:31499114-31499136 AGGCAGGAGGCTAAGGCAGGAGG - Intronic
1182896849 22:33866090-33866112 AGGCCGGAGGCTGAGGCAGGAGG - Intronic
1183095998 22:35552668-35552690 GGAGAGGAGGCTGAGGAACGCGG - Exonic
1183163369 22:36129531-36129553 AAGGAAGAGGCTGGGACAGGGGG + Intergenic
1183205259 22:36414514-36414536 ACTTAGGAGGCTGAGACAAGAGG - Intergenic
1183207794 22:36431645-36431667 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1183265819 22:36824379-36824401 AGGGAGGAGGCTGGTCCACAGGG + Intergenic
1183318646 22:37150320-37150342 TGGGAGGAGGGTGAGACGCTGGG - Intronic
1183337889 22:37261076-37261098 AGGGCGGACGCTGAGAGACCCGG + Intergenic
1183400000 22:37597494-37597516 AGTGGGGAGGCTGAGGCAGGAGG + Intergenic
1183475604 22:38034267-38034289 AGGGAAGAGGCTGTGGCCCGAGG - Intronic
1183946070 22:41326483-41326505 AGTGAGGAGGCTGAGACTATGGG - Intronic
1183989631 22:41589450-41589472 AGGGAGGAGGCTGCGAGCAGGGG - Intronic
1184002467 22:41685282-41685304 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1184125344 22:42482841-42482863 ATTTAGGAGGCTGAGACAGGAGG - Intergenic
1184132837 22:42528016-42528038 ACGCAGGAGGCTGAGGCAGGAGG - Intergenic
1184133828 22:42534332-42534354 ATTTAGGAGGCTGAGACAGGAGG - Intergenic
1184230285 22:43155030-43155052 AGGAAGGAGGCTGAGACGGGCGG + Intronic
1184338279 22:43868833-43868855 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1184409620 22:44318987-44319009 AGGATGGAGGCTCAGACACTTGG + Intergenic
1184913127 22:47549316-47549338 AGGGAGGAGCCCGAGAGAAGAGG - Intergenic
1185025381 22:48406865-48406887 ACGCAGGAGGCTGAGGCAGGAGG - Intergenic
1185072860 22:48666872-48666894 ATGAAGGAGGCTGAGACAGTCGG - Intronic
1185295987 22:50055110-50055132 AGGGAGGAGGCTGCAGCTCGGGG + Intronic
1185409348 22:50674208-50674230 AGGGCGGGGGCCGAGCCACGGGG - Intergenic
949118962 3:362558-362580 AGGGACTAGGCTGAGGCAAGTGG - Intronic
949322230 3:2824216-2824238 TGGGAGGAGGCCGAGGCAGGTGG + Intronic
949661409 3:6283493-6283515 AGGCAGGAGCCTTAGACAGGTGG - Intergenic
949736783 3:7181715-7181737 ACTGGGGAGGCTGAGACAAGAGG - Intronic
949950044 3:9221426-9221448 ACTCAGGAGGCTGAGACAGGAGG + Intronic
949965961 3:9356479-9356501 ACGCAGGAGGCTGAGGCAGGAGG - Intronic
950232041 3:11284658-11284680 ACTCAGGAGGCTGAGACAGGAGG - Intronic
950325939 3:12110078-12110100 ACTGGGGAGGCTGAGACAAGAGG + Intronic
950365201 3:12478446-12478468 ACCCAGGAGGCTGAGACAGGAGG + Intergenic
950386813 3:12666497-12666519 AGGGAGGAGGCTGAGGCTGGAGG + Intergenic
950598166 3:14004610-14004632 ACTCAGGAGGCTGAGACAGGAGG - Intronic
950728528 3:14935692-14935714 ACTTAGGAGGCTGAGACAGGAGG + Intergenic
950734534 3:14994804-14994826 ACTCAGGAGGCTGAGACAGGAGG + Intronic
952090495 3:29878937-29878959 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
952251305 3:31658236-31658258 ACTCAGGAGGCTGAGACAGGAGG - Exonic
952320175 3:32269884-32269906 ACTCAGGAGGCTGAGACAGGAGG - Intronic
952408762 3:33028007-33028029 ACTCAGGAGGCTGAGACAGGAGG - Intronic
952525592 3:34207149-34207171 AGGGAGGAGTATAGGACACGAGG - Intergenic
953307890 3:41846694-41846716 ACTGGGGAGGCTGAGACAGGAGG + Intronic
953338328 3:42112877-42112899 ACTGGGGAGGCTGAGACAAGAGG - Intronic
953487396 3:43314986-43315008 ACTCAGGAGGCTGAGACAGGAGG + Intronic
953498558 3:43410357-43410379 TGGGAGGAGGCTGAAGCAAGAGG - Intronic
953746159 3:45575575-45575597 AAGGAGGAGACTGAGAAAAGGGG - Intronic
953875191 3:46662597-46662619 AGGGAGGAGGCTGGGGCAGGAGG + Intergenic
953917514 3:46930116-46930138 ATTCAGGAGGCTGAGACAGGAGG - Intronic
954181735 3:48886735-48886757 ACGCAGGAGGCTGAGACGGGAGG + Intronic
954288779 3:49637996-49638018 AGGAAGGCTCCTGAGACACGAGG + Intronic
954316916 3:49806312-49806334 GGGGAGGGGGCTGAGACTCTGGG - Intronic
954639944 3:52091888-52091910 AGGGAGGAGACTGAGGCTCTGGG + Intronic
954643625 3:52117242-52117264 ACTCAGGAGGCTGAGACAGGAGG + Intronic
954805208 3:53214975-53214997 ACTGAGGAGGCTGAGGCAGGGGG + Intergenic
954818810 3:53306807-53306829 ATGGTGGAGGCTGAGACAGGTGG + Intronic
954829335 3:53406010-53406032 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
954837542 3:53482879-53482901 ACGCAGGAGGCTGAGGCAGGAGG + Intergenic
954860282 3:53682446-53682468 ACTCAGGAGGCTGAGACAGGAGG + Intronic
954933088 3:54301146-54301168 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
955158275 3:56439199-56439221 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
955204946 3:56887400-56887422 CAGGAGGAGGCTGAGACTCTGGG + Intronic
955218538 3:57004849-57004871 ACTCAGGAGGCTGAGACAGGTGG + Intronic
955270655 3:57494898-57494920 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
955319367 3:57963433-57963455 AGGAAGGAGGCTGAGGCAGGAGG - Intergenic
955732035 3:61997417-61997439 AGAGAGCAGGATGGGACACGAGG - Intronic
956191321 3:66611011-66611033 AGGGAGGAGGCTGAGGCTGGAGG - Intergenic
956297518 3:67730334-67730356 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
956307738 3:67844915-67844937 AAGGAGGAGTCTGAGAAATGAGG - Intergenic
956742184 3:72283874-72283896 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
956777367 3:72576564-72576586 AGGCTGGAGGCTGAGGCAGGAGG + Intergenic
956819498 3:72940788-72940810 ACTCAGGAGGCTGAGACAGGAGG - Intronic
957104761 3:75872568-75872590 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
957378428 3:79391182-79391204 ACCGAGGAGGCTGAGGCAGGAGG + Intronic
957462879 3:80545138-80545160 AGGGAGCAGGGTAAGACAGGAGG + Intergenic
957728983 3:84107244-84107266 AGGCAGGAGGCTGAGGCGAGAGG + Intergenic
957924097 3:86786810-86786832 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
958420893 3:93929368-93929390 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
958797560 3:98722139-98722161 AGTCAGGAGGCTGAGACAGGAGG + Intergenic
959105980 3:102064436-102064458 ACTGAGAAGGCTGAGACAGGGGG - Intergenic
959326280 3:104940858-104940880 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
959358988 3:105366847-105366869 AGGGAGGAGGCGGGGAGAGGAGG + Intergenic
959524498 3:107361336-107361358 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
960071032 3:113431168-113431190 AGGTATGAGGCTGAGCCAGGAGG + Intronic
960381643 3:116970047-116970069 ACTGAGGAGGCTGAGGCAAGAGG - Intronic
960975383 3:123168770-123168792 ACCCAGGAGGCTGAGACAGGAGG + Intronic
961010498 3:123432637-123432659 AGTTAGGAGGCTGAGGCAAGAGG - Intronic
961147246 3:124604793-124604815 ACTCAGGAGGCTGAGACAAGAGG - Intronic
961154245 3:124665571-124665593 ACTTAGGAGGCTGAGGCACGAGG - Intronic
961234047 3:125348370-125348392 ACTCAGGAGGCTGAGACAGGAGG + Intronic
961576806 3:127843769-127843791 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
961644563 3:128385800-128385822 AGGCAGGAGGCTGAGGCCTGGGG + Intronic
961675872 3:128566175-128566197 AGTTGGGAGGCTGAGACAGGAGG + Intergenic
961698612 3:128724463-128724485 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
961921634 3:130432440-130432462 ACTCAGGAGGCTGAGACAGGAGG + Intronic
961932303 3:130547207-130547229 AGGGAGGTGGCTGAGGCCCAGGG + Intergenic
962029080 3:131580550-131580572 ATGGAGGAGTCAGAGACACGTGG + Intronic
962182254 3:133220383-133220405 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
962240727 3:133748668-133748690 AGGTAGGAGGCTGATATATGGGG + Intronic
962304455 3:134273240-134273262 AGGCCAGAGGCTGAGACACCAGG + Intergenic
962577574 3:136769027-136769049 AGGCAGGAGGCTGAGGCAGGAGG + Intergenic
962591304 3:136891995-136892017 ACTCAGGAGGCTGAGACAGGAGG - Intronic
962647121 3:137451325-137451347 AGGGAGGAGAAGAAGACACGAGG - Intergenic
962702813 3:138015622-138015644 ATGCAGGAGGCTGAGACAGAAGG + Intronic
962739770 3:138354887-138354909 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
962787380 3:138780775-138780797 ACTTAGGAGGCTGAGACAGGAGG - Intronic
963157307 3:142112762-142112784 ACTCAGGAGGCTGAGACAAGAGG - Intronic
963198776 3:142565650-142565672 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
963504873 3:146171855-146171877 ACTAAGGAGGCTGAGACAGGAGG - Intergenic
963997505 3:151727051-151727073 AGGCAGGAGGCTGAGGCAGGAGG + Intergenic
964750427 3:160049158-160049180 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
965270994 3:166617321-166617343 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
965598134 3:170427698-170427720 ACGCAGGAGGCTGAGGCACGAGG + Intronic
966404362 3:179579881-179579903 ACTGAGGAGGCTGAGGCAGGGGG - Intronic
966470064 3:180279274-180279296 AGGGAGGAGGACAAGACAGGGGG + Intergenic
966793148 3:183691520-183691542 AGGAAGGAGGCTGGGATACTGGG + Intergenic
967111761 3:186299941-186299963 TGGGAGGAGGCTGAGGCGTGAGG - Intronic
967162968 3:186755605-186755627 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
967192854 3:186999944-186999966 ACTCAGGAGGCTGAGACAGGAGG - Intronic
967306368 3:188063498-188063520 ATGTGGGAGGCTGAGACAGGTGG - Intergenic
967352273 3:188527031-188527053 AGGGAGTAGCCTGAGCCACAGGG + Intronic
968033668 3:195526721-195526743 AGCTAGGAGGCTGAGGCAGGAGG - Intronic
968034212 3:195532137-195532159 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
968223203 3:196953882-196953904 ATTCAGGAGGCTGAGACAAGAGG + Intronic
968320016 3:197758144-197758166 AGGCAGGAGGCCGAGGCAGGTGG - Intronic
968588952 4:1448314-1448336 AGGGAGGAGGCTGGGACATGAGG + Intergenic
968618894 4:1594732-1594754 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
968644760 4:1734887-1734909 AGGGTGGAGGCTGAGGCGAGTGG - Intronic
968658303 4:1787966-1787988 AGGGAGGAGGGTGTGACGTGGGG + Intergenic
968685447 4:1954939-1954961 AGTGCCCAGGCTGAGACACGCGG + Intronic
968854447 4:3108937-3108959 ACTCAGGAGGCTGAGACAGGAGG + Intronic
968929975 4:3573626-3573648 CGGGAGGGGGGTGTGACACGTGG + Intergenic
968992330 4:3922857-3922879 GGGAGGGAGGCTGAGACAGGAGG + Intergenic
969450250 4:7268873-7268895 ATGGAGGAGGCTGATACTCAGGG + Intronic
969492479 4:7507783-7507805 AGGGAGCTGGCTGGAACACGGGG + Intronic
969495331 4:7523090-7523112 AGGGAGGAGGCAGAGGGAGGAGG - Intronic
969495335 4:7523103-7523125 AGGGAGGAGGCAGAGGGAGGAGG - Intronic
969758172 4:9163626-9163648 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
969818146 4:9701157-9701179 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
970045196 4:11844460-11844482 ACTCAGGAGGCTGAGACCCGAGG + Intergenic
970605998 4:17682382-17682404 AGGGAGAAGGCTGCCAAACGTGG - Intronic
971559156 4:28052766-28052788 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
971743023 4:30544319-30544341 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
972341350 4:38155107-38155129 TGGGAGGATGCAGAGCCACGGGG - Intergenic
972527113 4:39925001-39925023 ACTCAGGAGGCTGAGACAGGAGG + Intronic
972572753 4:40326041-40326063 ATGGGGGAGGCTGAGGCAGGAGG - Intergenic
973335421 4:48950968-48950990 ACACAGGAGGCTGAGACAGGAGG + Intergenic
973916436 4:55638615-55638637 ACTTAGGAGGCTGAGACAGGAGG - Intergenic
974028539 4:56755502-56755524 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
974075548 4:57165188-57165210 AGGGAGCAGGCTGAGGTAGGAGG + Intergenic
975324937 4:73048870-73048892 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
975561315 4:75710773-75710795 ACGTGGGAGGCTGAGACAGGAGG - Intronic
975645775 4:76544523-76544545 AGCCAGGAGGCTGAGGCAGGAGG - Intronic
976166752 4:82264192-82264214 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
976314256 4:83642668-83642690 AGGGAAGAGGCTGAGCCATTTGG - Intergenic
976419414 4:84822601-84822623 AGGCAGGAGGCTGAGGCAGGAGG + Intronic
976600933 4:86936403-86936425 AGGTAGGAGTCTGAGAGGCGTGG + Intronic
976601904 4:86945607-86945629 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
976652199 4:87447921-87447943 ACACAGGAGGCTGAGACAGGAGG + Intronic
976658873 4:87518350-87518372 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
976670435 4:87646369-87646391 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
976811575 4:89105712-89105734 AGGGAGCTGGCTGAGATACCCGG + Intronic
978410836 4:108423683-108423705 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
978800682 4:112752772-112752794 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
979254007 4:118592910-118592932 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
979334974 4:119453433-119453455 AGTTAGGAGGCTGAGGCAGGAGG - Intergenic
979376066 4:119948308-119948330 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
979647218 4:123084735-123084757 AGTTGGGAGGCTGAGACAGGAGG - Intronic
979999113 4:127467860-127467882 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
980038485 4:127912555-127912577 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
980059660 4:128115460-128115482 ACTCAGGAGGCTGAGACAGGAGG + Intronic
980910318 4:138988279-138988301 GGGGAGGAGGCTGAGATGGGAGG - Intergenic
981028917 4:140104274-140104296 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
981289011 4:143052263-143052285 ACTAAGGAGGCTGAGACAGGAGG - Intergenic
981522245 4:145675398-145675420 ATTTAGGAGGCTGAGACAGGAGG - Intergenic
981932766 4:150208644-150208666 AGGGAGGAGGCTGGGTGAAGAGG + Intronic
982369796 4:154622615-154622637 ACACAGGAGGCTGAGACAGGAGG + Intergenic
982457285 4:155625371-155625393 ACTGAGGAGGCTGAGACAGGAGG + Intergenic
982666644 4:158272645-158272667 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
982979337 4:162112349-162112371 ACTGGGGAGGCTGAGACAGGAGG - Intronic
983287811 4:165761341-165761363 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
983293387 4:165834892-165834914 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
983631341 4:169852708-169852730 ATGGATGAGGCTGTGACACAGGG - Intergenic
983742544 4:171153264-171153286 AGTGAGGAGGCTGAGAGAGATGG - Intergenic
983972739 4:173894467-173894489 AGGCAGAAGGCTAAGACATGAGG - Intergenic
984024569 4:174527625-174527647 AAGGAGGAGGCTTTGACACAAGG + Intergenic
984655942 4:182318874-182318896 ACTCAGGAGGCTGAGACAGGGGG - Intronic
984740095 4:183153002-183153024 ACTGCGGAGGCTGAGACAGGAGG - Intronic
984822486 4:183894041-183894063 ACTTAGGAGGCTGAGGCACGAGG + Intronic
984832200 4:183986369-183986391 AGGGAGGAGACAGTGCCACGGGG + Intronic
985080064 4:186255456-186255478 AGTCAAGAGGCTGAGACAAGAGG + Intronic
985087001 4:186324318-186324340 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
985133703 4:186764650-186764672 TGGTAGGAGGCTGAGACAGGAGG - Intergenic
985626486 5:991600-991622 AGGGAGGTGGGTGAGACAGATGG + Intergenic
985664622 5:1175550-1175572 AGGGAGAAGGCAGAGACCAGAGG - Intergenic
985822875 5:2172156-2172178 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
985893045 5:2731023-2731045 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
986295820 5:6437616-6437638 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
986621896 5:9684630-9684652 ACCCAGGAGGCTGAGACAGGAGG - Intronic
987237024 5:15952811-15952833 ACTCAGGAGGCTGAGACAGGGGG + Intergenic
987538295 5:19217339-19217361 AGGCTGGAGGCTGAGACATTAGG - Intergenic
988491294 5:31707733-31707755 ACTCAGGAGGCTGAGACAGGAGG - Intronic
988836497 5:35037658-35037680 ACTCAGGAGGCTGAGACAGGAGG - Intronic
989014456 5:36913496-36913518 ATTTAGGAGGCTGAGACAGGTGG - Intronic
989587022 5:43082514-43082536 ACTCAGGAGGCTGAGACAGGAGG + Intronic
990308162 5:54513193-54513215 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
990575197 5:57117265-57117287 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
990976920 5:61568639-61568661 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
991068347 5:62448657-62448679 ACTCAGGAGGCTGAGACAGGAGG - Intronic
991069627 5:62462637-62462659 ACTCAGGAGGCTGAGACAGGAGG - Intronic
991396258 5:66208216-66208238 GGGGAGGAGGGTGAGGCAGGTGG + Intergenic
991728863 5:69563056-69563078 ACTGGGGAGGCTGAGACAAGAGG - Intronic
991771609 5:70046221-70046243 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
991805292 5:70418205-70418227 ACTGGGGAGGCTGAGACAAGAGG - Intergenic
991850901 5:70921639-70921661 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
991866092 5:71064817-71064839 ACTGGGGAGGCTGAGACAAGAGG + Intronic
991915356 5:71599452-71599474 ATTCAGGAGGCTGAGACAAGAGG - Intronic
991919871 5:71645951-71645973 ACTCAGGAGGCTGAGACAGGAGG + Intronic
991924490 5:71691379-71691401 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
992153302 5:73927600-73927622 ACTGAGGAGGCTGAGGCAGGGGG - Intronic
992396011 5:76370405-76370427 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
992434479 5:76742080-76742102 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
992458370 5:76937642-76937664 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
992488973 5:77222511-77222533 ACTCAGGAGGCTGAGACAGGAGG + Intronic
992832887 5:80612409-80612431 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
992945930 5:81810391-81810413 ACCCAGGAGGCTGAGGCACGAGG - Intergenic
992957264 5:81922631-81922653 AGGGAGGAGATTCAGACACTGGG + Intergenic
993074781 5:83215228-83215250 AGTTGGGAGGCTGAGACAGGAGG + Intronic
993116061 5:83721805-83721827 GGGGAAGATGCTGGGACACGCGG + Intergenic
993136383 5:83971383-83971405 ACTCAGGAGGCTGAGACAAGAGG - Intronic
993168451 5:84384954-84384976 AGAGAGGAGGGGGAGACCCGGGG - Intergenic
993706842 5:91180662-91180684 ACTCAGGAGGCTGAGTCACGGGG + Intergenic
993896485 5:93541450-93541472 AGGGAGGAGGCATAGCCACTAGG - Intergenic
994042780 5:95276707-95276729 TGGGAGGCGGCTGAGGCAGGTGG + Intronic
994467413 5:100155606-100155628 AGGGAGGAGGGTGGGAGAGGAGG - Intergenic
995146713 5:108795214-108795236 ACTCAGGAGGCTGAGACAGGAGG + Intronic
995357069 5:111250884-111250906 AGGTGGGAGGCTGAGATAAGAGG - Intronic
995723361 5:115160735-115160757 ATGTAGGAGGCTGAGGCAGGAGG + Intronic
995726884 5:115190747-115190769 AGTGAGAAGGCTGAGGCAGGAGG - Intergenic
995798718 5:115968545-115968567 AGTCAGGAGGCTGAGACAAGAGG - Intronic
996000790 5:118361172-118361194 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
996136843 5:119853417-119853439 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
996904127 5:128578102-128578124 ACTCAGGAGGCTGAGACAGGAGG - Intronic
997087315 5:130817325-130817347 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
997122822 5:131193764-131193786 TGGTGGGAGGCTGAGGCACGTGG + Intronic
997310955 5:132882102-132882124 ACTCAGGAGGCTGAGGCACGAGG + Intronic
997503393 5:134396648-134396670 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
997893537 5:137695860-137695882 AGGGAGGAGGCTGAGATCAGAGG + Intronic
997927247 5:138041950-138041972 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
998120204 5:139570156-139570178 ACTCAGGAGGCTGAGACAGGAGG + Intronic
998259334 5:140616932-140616954 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
998271757 5:140712914-140712936 CTGGAGGAGGCTGAGGCAGGAGG - Intergenic
998273367 5:140727695-140727717 CGGGAGGAGGCTGAGGCAGGAGG - Intergenic
998356362 5:141540223-141540245 GAGAAGGAGGCTGAGACAGGAGG - Intronic
998553191 5:143097234-143097256 GGGGAGGCGGCTGAGGCAGGAGG + Intronic
998833962 5:146186407-146186429 AGGCAGGAGGCTGAGGCAGGAGG + Intergenic
999162224 5:149511220-149511242 AGGTAGGAGGCTGAGATAGGAGG + Intronic
999408295 5:151326418-151326440 AGTGGGGAGGCTGAGACTCCAGG + Intronic
999809583 5:155115016-155115038 AGGGAGGCAGCTGAGGCCCGGGG - Intergenic
1000018488 5:157299303-157299325 AGGAAGGAGGCAGAGAGATGGGG - Intronic
1000901725 5:166919479-166919501 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1001392630 5:171392046-171392068 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1001567209 5:172707331-172707353 AGGGACGGGGCAGAGGCACGAGG + Intergenic
1001666322 5:173436341-173436363 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1001743483 5:174072170-174072192 AGGGAGAGGGCTGGGACAGGTGG - Intronic
1001806203 5:174588846-174588868 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1002022390 5:176372094-176372116 AGGGAGGTGGGTGAGACAGAGGG + Exonic
1002397992 5:178972733-178972755 AGGCCTGAGGCTGAGCCACGTGG + Intergenic
1002401258 5:178992659-178992681 AGTGTGGAGGCAGAGACACGGGG + Intronic
1002455291 5:179342804-179342826 AGGGAGGAGGCTGACATTGGCGG - Intronic
1002482234 5:179510242-179510264 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1002511530 5:179722223-179722245 AGGCACGAGGCTGAGGCACAAGG + Intronic
1002514610 5:179748189-179748211 ACTCAGGAGGCTGAGACACAAGG - Intronic
1002609960 5:180410494-180410516 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1002630520 5:180572656-180572678 AGCGGGGAGGCTGAGGCAGGAGG - Intronic
1002953723 6:1841770-1841792 AGGAAGGACGCTGACACAGGTGG + Intronic
1002981885 6:2145782-2145804 ACTTAGGAGGCTGAGACAAGAGG + Intronic
1003092064 6:3112637-3112659 ACTGAGGAGGCTGAGACAGGAGG - Intronic
1003149408 6:3536218-3536240 GGGGAGCCGGCTGCGACACGGGG + Intergenic
1003310771 6:4968195-4968217 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1003594360 6:7461264-7461286 GGGGAGGAGGCTGTGACCCCAGG + Intergenic
1004054977 6:12126964-12126986 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1004119512 6:12806558-12806580 AGGAGGGAGGCTGAGGCAGGAGG - Intronic
1004127665 6:12889161-12889183 AGGTGGGAGGCTGAGGCAGGAGG + Intronic
1004225055 6:13777534-13777556 AGGCAGGAGGCTCAGGCAGGAGG - Intergenic
1004232450 6:13845797-13845819 AGTGGGGAGGCTGAGACAGGAGG - Intergenic
1004333746 6:14744875-14744897 ACGGAGGAGGCTGAGGCAGAAGG + Intergenic
1004365190 6:15006840-15006862 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1004393670 6:15229874-15229896 ACTCAGGAGGCTGAGACAAGAGG - Intergenic
1004410428 6:15376613-15376635 AGTCAAGAGGCTGAGACAGGAGG + Intronic
1004607359 6:17206609-17206631 GGGGAGGAGGCTGAGGCCTGCGG + Intergenic
1004621197 6:17331939-17331961 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1004713236 6:18192151-18192173 ACTTAGGAGGCTGAGACAGGAGG + Intronic
1004731091 6:18359966-18359988 ACTTAGGAGGCTGAGACAGGAGG - Intergenic
1004942877 6:20579715-20579737 AGAGGGGAGGCTGAGGCACACGG - Intronic
1005171165 6:22986801-22986823 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
1005434715 6:25796495-25796517 ACCCAGGAGGCTGAGGCACGAGG + Intronic
1005445126 6:25915025-25915047 AGGGAGAAGGCTGAGGCACAAGG - Intronic
1005503060 6:26446835-26446857 ACTGGGGAGGCTGAGACAGGAGG - Intronic
1005520703 6:26598201-26598223 AGGGAGAAAGATGAGACAAGGGG - Intronic
1005640152 6:27788298-27788320 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1005890710 6:30135648-30135670 AGGGAGGAGGCTCTGAAATGAGG + Intergenic
1006105553 6:31714134-31714156 AGGGAGCAGCTTGAGACATGGGG - Intronic
1006355981 6:33558184-33558206 ACTGGGGAGGCTGAGACAGGAGG + Intergenic
1006464322 6:34182552-34182574 ACTCAGGAGGCTGAGACATGAGG + Intergenic
1006519407 6:34562771-34562793 AGGGAGGAAACTGAGGCACGGGG + Intergenic
1006554414 6:34853283-34853305 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1006781245 6:36633874-36633896 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1006861821 6:37176726-37176748 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
1007098405 6:39228512-39228534 AGCGGGGAGGTGGAGACACGAGG + Intronic
1007591450 6:43023288-43023310 ACTGAGGAGGCTGAGGCATGAGG + Intronic
1007613055 6:43162757-43162779 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1007769634 6:44182680-44182702 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1007773585 6:44210395-44210417 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1007778081 6:44234851-44234873 TGGGAGGAGTCTGAGACTTGTGG - Intergenic
1007878112 6:45130185-45130207 AGGGAAGATGCTGAGAGAGGGGG - Intronic
1008101176 6:47392763-47392785 AGGGAGGAGGCAGAGAAAGATGG - Intergenic
1008487453 6:52051537-52051559 AGGGAGAGGGCGGAGACAAGAGG - Intronic
1008657340 6:53629400-53629422 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1008668596 6:53743332-53743354 AGGAAGGAGGGTGAGATAGGTGG + Intergenic
1008802899 6:55391639-55391661 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1008948196 6:57123057-57123079 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1009388989 6:63122512-63122534 AGCCAGGAGGCTGAGGCAGGAGG + Intergenic
1009818195 6:68763962-68763984 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1010066562 6:71688809-71688831 AGGGAGGAGGATGAGAAGGGGGG - Intergenic
1010205262 6:73316760-73316782 ATGAGGGAGGCTGAGACAGGAGG + Intergenic
1010649767 6:78439529-78439551 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1010781464 6:79949909-79949931 AGGCAGGAGGATGAGGCAGGAGG - Intergenic
1011532091 6:88333813-88333835 ACGGTGGAGGCTGAGGCAGGAGG + Intergenic
1011547941 6:88501031-88501053 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1011739956 6:90349750-90349772 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1012138243 6:95585917-95585939 ATGTGGGAGGCTGAGACAGGAGG + Intronic
1012229369 6:96742398-96742420 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1012234454 6:96797120-96797142 ATTCAGGAGGCTGAGACAGGAGG + Exonic
1012779933 6:103545603-103545625 ACTCAGGAGGCTGAGACACGAGG + Intergenic
1013103659 6:107008535-107008557 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1013135887 6:107282499-107282521 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1013230101 6:108154731-108154753 ACTTAGGAGGCTGAGACAGGAGG + Intronic
1013420804 6:109964827-109964849 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1013497565 6:110713513-110713535 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1013698814 6:112738138-112738160 ACAGAGGAGGCTGAGGCAGGAGG - Intergenic
1013760495 6:113511889-113511911 AGTCAGGAGGCTGAGAAAGGTGG + Intergenic
1014437330 6:121435519-121435541 AGGGAGGAGGCTGGTAAATGTGG - Intergenic
1014657920 6:124131251-124131273 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1015213321 6:130721849-130721871 AGGGAGGAGGCTGGGAGCAGAGG - Intergenic
1015303689 6:131682383-131682405 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1015446833 6:133315968-133315990 TGGGAGCAGGCTGTGACACTAGG + Intronic
1016940488 6:149479250-149479272 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1017139046 6:151174040-151174062 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1017427593 6:154338811-154338833 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1017716147 6:157214815-157214837 TGGTGGGAGGCTGAGACAGGAGG + Intergenic
1017808971 6:157970487-157970509 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1017831711 6:158136601-158136623 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1017858569 6:158374176-158374198 ACGTGGGAGGCTGAGACAGGAGG + Intronic
1017902306 6:158728942-158728964 AGGCAGGAGGCTGAGGCAGGAGG + Intronic
1018724690 6:166602745-166602767 AGGGAGAAGGATGAGACTGGGGG + Intronic
1018844702 6:167547483-167547505 AGGGAGGAGGGAGAGAGACAAGG - Intergenic
1018933417 6:168257410-168257432 AGGGAAGAGACTGAGACAAAGGG - Intergenic
1019035979 6:169058984-169059006 AAGGTGGAGGATTAGACACGTGG - Intergenic
1019276967 7:180868-180890 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1019326200 7:439498-439520 GGGGAAGAGGCTGAGCCACCAGG - Intergenic
1019326445 7:440739-440761 TGGGAGGAGGAAGAGACACCAGG - Intergenic
1019332270 7:466381-466403 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019332275 7:466394-466416 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019332280 7:466407-466429 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019332293 7:466443-466465 AGGTAGGAGGGTGAGAGAGGAGG - Intergenic
1019332327 7:466575-466597 AGGGAGGAGGCTGATGGAGGAGG - Intergenic
1019332370 7:466741-466763 AGGGATGAGGGTGAGAGATGAGG - Intergenic
1019332406 7:466864-466886 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019448829 7:1085587-1085609 CTGAAGGAGGCTGAGACAGGAGG + Intronic
1019465046 7:1183375-1183397 ATGGGGGAGGCTGAGTCAGGAGG - Intergenic
1019489531 7:1305705-1305727 AAGAAGGAGGCAGAGACACCAGG - Intergenic
1019684155 7:2371297-2371319 AGGAAGGAGGCCAAGAAACGGGG - Intronic
1019805212 7:3118551-3118573 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1019861077 7:3658721-3658743 ACTCAGGAGGCTGAGACATGAGG - Intronic
1020028168 7:4914092-4914114 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1020039919 7:4994210-4994232 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1020047242 7:5049830-5049852 ATGCAGGAGGCTGAGGCAGGAGG - Intronic
1020080031 7:5282219-5282241 AGGGAGGAGGGGGAGAAAAGAGG + Intronic
1020126456 7:5535262-5535284 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1020426686 7:8074574-8074596 AATTAGGAGGCTGAGACAAGAGG + Intronic
1021247420 7:18280652-18280674 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1021729392 7:23581679-23581701 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1021805513 7:24350749-24350771 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1022093883 7:27125927-27125949 AGGGAGGAGGCTGAGATATAGGG + Intronic
1022112732 7:27241295-27241317 CGGGAGGAGGCGGAGAAAGGGGG + Intergenic
1022242627 7:28527710-28527732 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1022504885 7:30903692-30903714 TGGGAGCTGGCTGAGACAGGGGG + Intergenic
1022755134 7:33279182-33279204 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1023061365 7:36330327-36330349 AGGTGGGAGGCTGAGGCAGGAGG - Intronic
1023236494 7:38095680-38095702 AGCCAGGAGGCTGAGACGGGAGG + Intergenic
1023330388 7:39109152-39109174 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1023487197 7:40699758-40699780 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1023819743 7:43973965-43973987 AGGGAGGTGAAGGAGACACGTGG - Intergenic
1023829364 7:44029832-44029854 GGGGAGGAGGAGGAGACACGGGG - Intergenic
1023928760 7:44691421-44691443 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1023933392 7:44721583-44721605 TGGGAGGAGGCTGAGTCGGGTGG - Intergenic
1024069079 7:45770249-45770271 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
1024182637 7:46911387-46911409 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1025198885 7:56949997-56950019 AGGGAGGAGGGGGAGAAAAGAGG - Intergenic
1025611647 7:63079861-63079883 ACTGAGAAGGCTGAGACATGTGG + Intergenic
1025673061 7:63626936-63626958 AGGGAGGAGGGGGAGAAAAGAGG + Intergenic
1025694647 7:63768669-63768691 TGGGAGGAGGCTCAGCCTCGCGG - Intergenic
1025874974 7:65472697-65472719 TGGGAGGAGGCTGAGGCAGGTGG - Intergenic
1025942734 7:66085977-66085999 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1026047825 7:66919836-66919858 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1026076689 7:67178053-67178075 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1026113068 7:67473817-67473839 AGAGATGAGGCTGAGAAACTCGG - Intergenic
1026120300 7:67530794-67530816 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1026333317 7:69372319-69372341 AGTTAGGAGGCTGAGGCAGGAGG + Intergenic
1026365833 7:69647457-69647479 AGGAAGGAGGCTGAGATGGGAGG - Intronic
1026372318 7:69713567-69713589 AGTCAGGAGGCTGAGACAGGAGG - Intronic
1026419677 7:70221149-70221171 ATGCAGGAGGCTGAGACAGGGGG - Intronic
1026465800 7:70653144-70653166 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1026552501 7:71380442-71380464 ACTGAGGAGGCTGAGACAGGAGG - Intronic
1026586191 7:71658011-71658033 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1026632213 7:72047312-72047334 CGGAAGGAGGCTGAGAGTCGTGG + Intronic
1026700174 7:72634285-72634307 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1026727755 7:72883146-72883168 ACGCAGGAGGCTGAGGCAAGAGG - Intronic
1026773534 7:73217066-73217088 TGGGAGGAGGCTGAGGCAGAAGG - Intergenic
1026780129 7:73260756-73260778 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1026788258 7:73315466-73315488 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1026886376 7:73950171-73950193 ATTCAGGAGGCTGAGGCACGAGG - Intergenic
1026886470 7:73951239-73951261 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1026948262 7:74330170-74330192 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1026963306 7:74423541-74423563 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1026996829 7:74622520-74622542 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1027001897 7:74659334-74659356 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1027014393 7:74770460-74770482 TGGGAGGAGGCTGAGGCAGAAGG - Intergenic
1027020984 7:74814174-74814196 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1027024990 7:74844794-74844816 ACTCAGGAGGCTGAGGCACGAGG - Intronic
1027050955 7:75020903-75020925 ATTCAGGAGGCTGAGACATGTGG - Intronic
1027053711 7:75035894-75035916 ACTTAGGAGGCTGAGACAGGAGG + Intronic
1027062774 7:75099325-75099347 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1027067042 7:75131750-75131772 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1027073640 7:75175571-75175593 TGGGAGGAGGCTGAGGCAGAAGG + Intergenic
1027116083 7:75482579-75482601 AGGCGGGAGGCTGAGGCAAGAGG + Intronic
1027182462 7:75950417-75950439 AGGGAGGAGGGTGAGGGACAGGG + Intronic
1027230864 7:76271533-76271555 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1027392003 7:77713744-77713766 AGGGAGGAGGCCAAGGCATGAGG - Intronic
1027697610 7:81431554-81431576 ATTGGGGAGGCTGAGACAGGAGG + Intergenic
1027749179 7:82120073-82120095 ATTCAGGAGGCTGAGACATGAGG + Intronic
1028170747 7:87592467-87592489 AGGGAGGATACTGAGCCAGGTGG + Intronic
1028178383 7:87684637-87684659 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
1028542013 7:91952926-91952948 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1028568419 7:92259060-92259082 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1028894221 7:96022754-96022776 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1029139489 7:98400396-98400418 GGGGAGGAGGGGGAGACACACGG + Intronic
1029272945 7:99387789-99387811 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1029347527 7:99989295-99989317 ACGGGGGAGGCTGAGGCAGGAGG + Intergenic
1029376372 7:100179329-100179351 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1029406565 7:100378241-100378263 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1029443011 7:100598093-100598115 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1029483105 7:100824644-100824666 AACGTGGAGGCTGAGACAAGAGG - Intronic
1029485008 7:100834920-100834942 ATACAGGAGGCTGAGACAGGAGG + Intronic
1029498461 7:100911829-100911851 ACCCAGGAGGCTGAGACAGGAGG + Intergenic
1029526937 7:101100479-101100501 AGGGAGGAGGCTTGGCCACATGG - Intergenic
1029536457 7:101160409-101160431 ACGGGGGAGGCACAGACACGGGG - Intronic
1029545110 7:101206485-101206507 GGGGAGCAGGCAGATACACGGGG + Intronic
1029739670 7:102484090-102484112 GGGGAGGAGGAGGAGACACGGGG - Intronic
1029743550 7:102504570-102504592 GGGAAGGAGGCTGAGGCAGGAGG + Intronic
1029748016 7:102527418-102527440 AGGGAGGTGAAGGAGACACGTGG - Intergenic
1029757671 7:102583269-102583291 GGGGAGGAGGAGGAGACACGGGG - Intronic
1029765965 7:102626513-102626535 AGGGAGGTGAAGGAGACACGTGG - Intronic
1029775607 7:102682330-102682352 GGGGAGGAGGAGGAGACACGGGG - Intergenic
1030271091 7:107669064-107669086 ACTGAGGAGGCTGAGGCACAAGG - Intronic
1030571147 7:111226260-111226282 ACCGAGGAGGCTGAGAAAGGAGG - Intronic
1030962638 7:115946522-115946544 ACTCAGGAGGCTGAGACACAAGG - Intronic
1031052491 7:116958092-116958114 AGGTGGCAGGCTGAGACAGGAGG - Intronic
1031802975 7:126272657-126272679 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1031894858 7:127337169-127337191 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1031928127 7:127657599-127657621 CAGGAGGAGGCTGAGGCAGGAGG - Intronic
1032042558 7:128575459-128575481 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1032131550 7:129233291-129233313 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1032554522 7:132817746-132817768 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1032827080 7:135581436-135581458 ACGCAGGAGGCTGAGGCAGGAGG + Intronic
1032877126 7:136049698-136049720 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1033139265 7:138810394-138810416 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1033154555 7:138945815-138945837 AGTTTGGAGGCTGAGACAGGAGG + Intronic
1033304814 7:140217299-140217321 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1033321190 7:140341042-140341064 ACTTAGGAGGCTGAGACAGGAGG - Intronic
1033333679 7:140435141-140435163 ACGCAGGAGGCTGAGGCAGGAGG - Intergenic
1033345752 7:140524682-140524704 ACGCAGGAGGCTGAGGCAGGAGG - Intronic
1034068828 7:148162889-148162911 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1034145937 7:148871681-148871703 ACTTAGGAGGCTGAGACAGGAGG - Intronic
1034146741 7:148879998-148880020 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1034185961 7:149177354-149177376 TGGGAGGAGGTTGAGGCAGGTGG + Intronic
1034521080 7:151620584-151620606 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1034525403 7:151657026-151657048 ACTGGGGAGGCTGAGACAGGAGG + Intronic
1034554350 7:151840493-151840515 AGGCAGGAGGCTGAGATGGGAGG - Intronic
1034633872 7:152552040-152552062 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1034782815 7:153896702-153896724 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1034931594 7:155167810-155167832 CGGGATGAAGCTGACACACGAGG + Intergenic
1034973707 7:155435989-155436011 ATGGGGGAGGCTGGGACATGGGG - Intergenic
1034990556 7:155545283-155545305 AGGGTGGAGTCTAAGACACCAGG - Intergenic
1035118598 7:156546097-156546119 GGGGAGGAGACTGAGAAACGTGG + Intergenic
1035355399 7:158273519-158273541 TGGGAGGAGCCGCAGACACGGGG + Intronic
1035355418 7:158273593-158273615 TGGGAGGAGCCGCAGACACGGGG + Intronic
1035355456 7:158273770-158273792 TGGGAGGAGCCGCAGACACGGGG + Intronic
1035355529 7:158274105-158274127 TGGGAGGAGCCGCAGACACGGGG + Intronic
1035355604 7:158274433-158274455 TGGGAGGAGCCGCAGACACGGGG + Intronic
1035419428 7:158714462-158714484 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1035680753 8:1485916-1485938 CAGGAGGAGGCTGAGGCAGGAGG + Intergenic
1035735593 8:1884871-1884893 AGTGAGGAGGCTGAGGCAGGAGG - Intronic
1035922254 8:3690251-3690273 TGGGAGGAGGCTGAGTCAGAAGG + Intronic
1035977623 8:4330479-4330501 ACTTAGGAGGCTGAGACAGGAGG + Intronic
1036098356 8:5750121-5750143 AGGGAGGTAGCTGAGGCAGGTGG + Intergenic
1036377814 8:8215550-8215572 ACTTAGGAGGCTGAGGCACGAGG + Intergenic
1036409108 8:8481950-8481972 AGTCGGGAGGCTGAGGCACGAGG + Intergenic
1036443713 8:8803682-8803704 AGGGAGGAGGCTGGGAGCAGTGG + Intronic
1036553096 8:9832530-9832552 AGGTGGGAGGCTGAGGCAGGAGG - Intergenic
1036659429 8:10698422-10698444 ATGGAGGAGGCAGGGACATGGGG + Intronic
1036668882 8:10766537-10766559 AGGGAGGAGGCTGAGACACGCGG - Intronic
1036731342 8:11268267-11268289 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1036988232 8:13561226-13561248 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1037031185 8:14107745-14107767 AGTCAGGAGGCTGAGACCAGAGG - Intronic
1037397811 8:18461167-18461189 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
1037447726 8:18983892-18983914 ACTAAGGAGGCTGAGACAGGAGG + Intronic
1037455601 8:19060523-19060545 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1037662475 8:20939619-20939641 AGGGAGGAGGATGGGACAGCTGG + Intergenic
1037663386 8:20945469-20945491 AGGGAGGAAGCTGAGGCTGGGGG - Intergenic
1037861358 8:22407817-22407839 ACTGAGGAGGCTGAGGCAGGGGG - Intronic
1037949592 8:23010204-23010226 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1038174429 8:25167170-25167192 AGGCAAGAGGCTGAGGCAGGAGG - Intergenic
1038247070 8:25868587-25868609 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1038452116 8:27646501-27646523 AGGGAGGAGGCCCAGTCACGGGG + Intronic
1038530759 8:28316672-28316694 ATGGAGAATGCTGAGACTCGAGG - Intergenic
1038598761 8:28915807-28915829 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1038701262 8:29851515-29851537 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1038774099 8:30512601-30512623 AGCCAGGAGGCTGAGGCAGGAGG - Intronic
1038843407 8:31206779-31206801 TGGTAGGAGGCTGAGGCAGGTGG + Intergenic
1039297295 8:36170046-36170068 AGGGAGGAGGCTATGGCAGGTGG + Intergenic
1039314453 8:36356225-36356247 AGGGTGGAAGCTGAAACACTTGG + Intergenic
1039564476 8:38540788-38540810 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1039907205 8:41795398-41795420 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1039989396 8:42475206-42475228 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1040049285 8:42996275-42996297 ACTCAGGAGGCTGAGGCACGAGG + Intronic
1040079783 8:43274948-43274970 AGGGAGGAGGATGAGGGAGGAGG - Intergenic
1040679831 8:49795509-49795531 AGGCAGGAGGCTGAGGAATGGGG + Intergenic
1040743585 8:50611873-50611895 ATGGAGGAGGCTGAGGTAGGAGG - Intronic
1040855080 8:51940656-51940678 AGGCAGGAGACTGAGAAACGAGG - Intergenic
1041022733 8:53654660-53654682 TGGGAGGAGGCTGAGACAGGCGG + Intergenic
1041050615 8:53931085-53931107 AAGGTGGAGGCAGAGACACACGG - Intronic
1041068544 8:54104407-54104429 GGGGAGGCGGCTGAGGCCCGGGG - Intergenic
1041120154 8:54578313-54578335 ATTCAGGAGGCTGAGACAAGAGG - Intergenic
1041290609 8:56304803-56304825 AGTCAGGAGGCTGAGGCAGGAGG - Intronic
1041311974 8:56526291-56526313 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1041455759 8:58057558-58057580 AGGGTGGAGGCTGAGAAAAGGGG - Intronic
1042200778 8:66277975-66277997 AGGGAGGAAACTGAGGCATGGGG + Intergenic
1042223822 8:66499474-66499496 TGGGAGGAGGCAGAGGCAGGTGG - Intronic
1042227924 8:66529105-66529127 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1042530181 8:69806655-69806677 AGGGAGGTGGGTGAGACAGTGGG - Intronic
1043063055 8:75529358-75529380 AGGGAGGTGACTGAGTCATGAGG - Intronic
1043258569 8:78167777-78167799 ACTGAGGAGGCTGAGATAAGTGG - Intergenic
1043851287 8:85219640-85219662 ACTCGGGAGGCTGAGACACGAGG + Intronic
1043853554 8:85240635-85240657 TGGGAGGAGGCTAAGGCAAGAGG + Intronic
1044111480 8:88280774-88280796 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1044248510 8:89979084-89979106 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1044558755 8:93592027-93592049 ACTGAGGAGGCTGAGACGAGAGG + Intergenic
1044663673 8:94615038-94615060 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1045013252 8:97976990-97977012 TGGGAGGAGGCTGAGGCCAGTGG + Intronic
1045047091 8:98289592-98289614 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1045217910 8:100166796-100166818 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1045349538 8:101325670-101325692 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1045527135 8:102950670-102950692 ACTCAGGAGGCTGAGACAAGAGG - Intronic
1045616073 8:103913330-103913352 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1045769245 8:105715289-105715311 ATTCAGGAGGCTGAGACAGGAGG + Intronic
1046031491 8:108787693-108787715 TGGGAGGAGACAGAGACAGGAGG - Intergenic
1046626541 8:116582387-116582409 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
1046644294 8:116767976-116767998 ACACAGGAGGCTGAGACAGGAGG + Intronic
1046645053 8:116776830-116776852 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1046742493 8:117844259-117844281 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1047200938 8:122766701-122766723 ACGCAGGAGGCTGAGGCACGAGG + Intergenic
1047283179 8:123463733-123463755 AGGAAGCAGGATGAGACACAGGG + Intronic
1047606370 8:126478577-126478599 TGGGAGGAGGCAGAGGCAGGTGG - Intergenic
1047989593 8:130272054-130272076 ACTGGGGAGGCTGAGACAGGAGG + Intronic
1048004987 8:130411904-130411926 AGGGTGGAGGCTGGGACACTGGG - Intronic
1048482613 8:134813656-134813678 TGGGAGGCGGCTGAGGCAGGTGG - Intergenic
1048752597 8:137697132-137697154 AGTGAGGAGGAGGAGACACAAGG + Intergenic
1048926794 8:139278609-139278631 AGACAGGAGGCAGAGACAGGCGG + Intergenic
1048975273 8:139668185-139668207 AGGGTGGAGGGTGAGAGAGGAGG + Intronic
1049116540 8:140693450-140693472 TGGAAGGAGGCTGAGGCAGGAGG + Intronic
1049139184 8:140936065-140936087 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1049141401 8:140958244-140958266 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1049152651 8:141045340-141045362 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1049555524 8:143279469-143279491 AGGGCGAAGGCTGAGAATCGGGG - Intergenic
1049736807 8:144212190-144212212 ACTTAGGAGGCTGAGACAGGAGG - Intronic
1049948715 9:623493-623515 GGTGAGGAGGCTGAGGCAGGAGG + Intronic
1049994331 9:1020368-1020390 ACTCAGGAGGCTGAGACAGGGGG - Intergenic
1050520376 9:6491584-6491606 AGGGAGGAGGCTGAGAAGTTTGG + Intronic
1050526264 9:6549391-6549413 AGGGAGGAGGTGGAGCCACACGG + Intronic
1050740435 9:8813477-8813499 ACCGAGGAGGCTGAGGCAGGAGG - Intronic
1051638042 9:19198635-19198657 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1051909816 9:22140436-22140458 ACTCAGGAGGCTGAGACATGAGG - Intergenic
1051966221 9:22832854-22832876 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1052307768 9:27030333-27030355 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1052707503 9:32010909-32010931 CTGGAGGAGGCTGAGAGACAGGG - Intergenic
1052712639 9:32075371-32075393 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1052716736 9:32127042-32127064 AGGTAAGAGGTTGAGACACTAGG - Intergenic
1052811035 9:33060260-33060282 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1053056044 9:34993630-34993652 AGGGAGGGGGCAGAGAGAGGCGG - Intronic
1053130278 9:35610570-35610592 AGGGATGGGGCTGAGGCATGGGG - Intronic
1053386475 9:37694643-37694665 ACACGGGAGGCTGAGACACGAGG - Intronic
1053434735 9:38067557-38067579 AGGGTGGAGGCTGGGATAAGGGG + Intronic
1053710606 9:40803184-40803206 GGAGAGGAGGCTGAGGCAGGAGG + Intergenic
1053801305 9:41766071-41766093 ACGCAGGAGGCTGAGTCAGGAGG + Intergenic
1054150685 9:61601313-61601335 ACTCAGGAGGCTGAGACAGGGGG - Intergenic
1054189735 9:61978225-61978247 ACGCAGGAGGCTGAGTCAGGAGG + Intergenic
1054338758 9:63834296-63834318 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1054420516 9:64923962-64923984 GGAGAGGAGGCTGAGGCAGGAGG + Intergenic
1054648780 9:67610367-67610389 ACGCAGGAGGCTGAGTCAGGAGG - Intergenic
1054795642 9:69298848-69298870 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1055151101 9:73001218-73001240 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1055264096 9:74475782-74475804 CTGGAGCAGGCTGAGACACAGGG - Intergenic
1055294721 9:74822356-74822378 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1055305337 9:74923562-74923584 AGTGGGGAGGATGAGACACGAGG + Intergenic
1056150937 9:83787479-83787501 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1056679142 9:88701908-88701930 GGGGAGGTGGCTGAGGCAGGAGG + Intergenic
1056901104 9:90600216-90600238 AGTGAGGAGGCTGAGAGAGGAGG - Intergenic
1056957033 9:91090786-91090808 AGGAAGGAGGAAGAGACAGGAGG - Intergenic
1057001046 9:91509570-91509592 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1057387646 9:94618534-94618556 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1058438721 9:104988276-104988298 ACTCAGGAGGCTGAGGCACGAGG - Intergenic
1058571200 9:106346899-106346921 AGGTAGGAGGGTGAGGCAGGAGG + Intergenic
1058661933 9:107274481-107274503 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1058890338 9:109355724-109355746 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1059193817 9:112352024-112352046 ACTCAGGAGGCTGAGACAAGAGG - Intergenic
1059254650 9:112918543-112918565 AGGGATGAGGCTGAGGCAGGGGG + Intergenic
1059405708 9:114097447-114097469 AGGGAGGAGGGTGAGGGAAGGGG + Intronic
1059490115 9:114659881-114659903 AGGGAGGAGGCTTAAACAGAGGG - Intergenic
1059714952 9:116905065-116905087 AGGAAGGAGGGGGAGACAAGAGG - Intronic
1059801343 9:117752514-117752536 AGGCAGGACTCTGAGACACCAGG - Intergenic
1059802161 9:117761306-117761328 AGGGATAAGCCTGAGACACATGG + Intergenic
1060253514 9:122005057-122005079 AGAAAGGAGGATGAGACACAGGG + Intronic
1060365431 9:123007484-123007506 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1060515077 9:124260500-124260522 CAGGAGGAGGCTGAGGCAGGAGG - Intronic
1060698989 9:125734347-125734369 AGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1060980041 9:127786409-127786431 GGGGAGGAGCCTGAGGCCCGTGG + Intronic
1061021476 9:128018322-128018344 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1061223444 9:129266145-129266167 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1061244573 9:129394821-129394843 AGGGAGGCGGCTGAGAGCCGTGG + Intergenic
1061435699 9:130560076-130560098 ACTCAGGAGGCTGAGGCACGAGG + Intergenic
1061451391 9:130668800-130668822 TGGGAGAAGCCTGACACACGGGG - Intronic
1061471322 9:130828306-130828328 TGGGGGGAGGCTGAGGCAGGAGG - Intronic
1061606472 9:131714814-131714836 AGTCAGGAGGCTGAGACAGGAGG - Intronic
1061612017 9:131753312-131753334 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1061620459 9:131808226-131808248 ACGCAGGAGGCTGAGGCAGGAGG - Intergenic
1061700055 9:132409293-132409315 ATGGGGGAGGCTGAGGCAGGAGG - Intergenic
1061761347 9:132854090-132854112 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1062349556 9:136132407-136132429 AGGGAGAAGGCTGGGACGAGGGG - Intergenic
1062418911 9:136469553-136469575 ATGCAGGAGGCTGAGGCAGGAGG + Intronic
1062455600 9:136636017-136636039 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1062480220 9:136747655-136747677 AGGGTGGAGGCTGAGGCTGGAGG - Intronic
1062485916 9:136775576-136775598 CGAGAGGAGGCTGAGTCAGGCGG - Intergenic
1062709532 9:137966896-137966918 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1062731001 9:138108890-138108912 TGGGAGGAGGCTGAGACGGGCGG - Intronic
1185531367 X:821531-821553 AGAGAGGAAGCTGACACAGGCGG - Intergenic
1185612395 X:1400642-1400664 AGGGGGGAGGCTGAGACAGGAGG - Intergenic
1185717430 X:2354042-2354064 GGGGAGGAGGAGGAGACACAGGG + Intronic
1185800870 X:3009361-3009383 AGTCAGGAGGCTGAGGCAGGAGG + Intronic
1186014731 X:5178643-5178665 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1186018574 X:5227185-5227207 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
1186034793 X:5410452-5410474 ACTGAGGAGGCTGAGGCAGGAGG - Intergenic
1186110467 X:6249754-6249776 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1186402934 X:9276341-9276363 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1187045375 X:15642986-15643008 ACTCAGGAGGCTGAGACAAGAGG + Intronic
1187246962 X:17561467-17561489 AGGGAGGAGGAAGAGCCAAGAGG + Intronic
1187367403 X:18676218-18676240 AAGGAGGAGACTGAGACCAGAGG - Intronic
1187552678 X:20321810-20321832 AGGGATGGGGCTGAGACTCATGG + Intergenic
1187950951 X:24469683-24469705 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1188038452 X:25344245-25344267 AGAGATGTGGCTGAGACAGGAGG + Intergenic
1188501028 X:30826173-30826195 ACTGAGGAGGCTGAGGCAGGAGG + Intergenic
1188507808 X:30901770-30901792 CGGGGTGAGGCTGAGGCACGAGG + Intronic
1188735143 X:33703966-33703988 ACTGAGGAGGCTGAGACAAAAGG - Intergenic
1188736741 X:33726593-33726615 CGTGAGGAAGCTGAGGCACGTGG - Intergenic
1189178355 X:38980351-38980373 AGGGAGGAGGGTGAGTTACAGGG - Intergenic
1189262012 X:39686095-39686117 ACTGGGGAGGCTGAGACAGGAGG + Intergenic
1189288539 X:39869085-39869107 AGAAAGGAGGCTGAGGCAGGAGG - Intergenic
1189342184 X:40212456-40212478 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1189391031 X:40577071-40577093 ACTGGGGAGGCTGAGACAGGAGG - Intergenic
1189400669 X:40665422-40665444 GGGGAGGAGGTTGAGGCAGGAGG + Intronic
1189752122 X:44232923-44232945 ACGCAAGAGGCTGAGGCACGAGG + Intronic
1189793458 X:44625022-44625044 AGTAAGGAGGCTGAGGCAGGAGG - Intergenic
1189957605 X:46291986-46292008 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1190017042 X:46836211-46836233 AGGAAGGAGGCTGAGGCAGGAGG + Intergenic
1190256796 X:48769410-48769432 ACTCAGGAGGCTGAGACAGGAGG + Intronic
1190289198 X:48981175-48981197 GGAGAGGAGGCTGAGGCATGGGG - Intronic
1190626243 X:52341169-52341191 ACTTGGGAGGCTGAGACACGAGG - Intergenic
1190857656 X:54312679-54312701 TGGGAGGAGGCCGAGGCAAGTGG - Intronic
1191193430 X:57691718-57691740 ATTCAGGAGGCTGAGACAGGAGG + Intergenic
1192163154 X:68803760-68803782 GGAGATGAGGCTGAGAAACGAGG + Intergenic
1192340034 X:70256840-70256862 ATGGAGGAGGCTGAGTCAGTTGG + Intergenic
1192477997 X:71460130-71460152 AGTTAGGAGGCTGAGGCAGGAGG + Intronic
1192488093 X:71548326-71548348 AAGAAGGAGGCTGAGGCAGGAGG + Intronic
1192550388 X:72048878-72048900 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1192570619 X:72201092-72201114 AGGAGGGAGGCTGAGGCAGGAGG + Intronic
1192627489 X:72745356-72745378 ACCCAGGAGGCTGAGACACGAGG + Intergenic
1192654219 X:72975457-72975479 ACCCAGGAGGCTGAGACACGAGG - Intergenic
1192776484 X:74250897-74250919 TGGTAGGAGGCTGAGGCAGGAGG + Intergenic
1193133357 X:77942552-77942574 ACACAGGAGGCTGAGACAGGAGG - Intronic
1193764843 X:85514873-85514895 AGAGAGGAGGCTGAGAGGAGAGG - Intergenic
1193769574 X:85573025-85573047 ATGCTGGAGGCTGAGACAGGAGG + Intergenic
1194038571 X:88911671-88911693 AATCAGGAGGCTGAGACAAGAGG + Intergenic
1194047723 X:89029864-89029886 ACTCAGGAGGCTGAGACAAGAGG + Intergenic
1195371569 X:104180084-104180106 ACTGAGGAGGCTGAGGCAAGAGG - Intronic
1195489244 X:105448471-105448493 ACTGAGGAGGCTGAGGCAGGGGG - Intronic
1195515096 X:105764695-105764717 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1195778490 X:108434409-108434431 TAGGAGGAGGCTGAGGCAGGAGG - Intronic
1195893840 X:109725187-109725209 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1196632729 X:117962100-117962122 ACTGAGGAGGCTGAGGCAGGAGG + Intronic
1196744586 X:119058643-119058665 ATTCAGGAGGCTGAGACAGGAGG - Intergenic
1196793533 X:119484916-119484938 AGGGAGGATGCAGAGAAAAGGGG - Intergenic
1197236199 X:124067375-124067397 ACTTAGGAGGCTGAGGCACGAGG - Intronic
1197267141 X:124386821-124386843 ACTCAGGAGGCTGAGACAGGAGG - Intronic
1197784966 X:130190059-130190081 ACTCAGGAGGCTGAGACAAGAGG - Intergenic
1197788778 X:130228747-130228769 ACTGAGGAGGCTGAGGCAGGAGG - Intronic
1197929149 X:131677930-131677952 AGGTGGGAGGCTGAGAGATGTGG + Intergenic
1198182925 X:134227076-134227098 AGTCAGGAGGCTGAGGCAGGAGG - Intergenic
1198401442 X:136272387-136272409 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1199770408 X:150971717-150971739 ATGCAGGAGGCTGAGGCAGGAGG + Intergenic
1200013677 X:153141271-153141293 ACTCAGGAGGCTGAGACAGGAGG - Intergenic
1200025924 X:153258647-153258669 ACTCAGGAGGCTGAGACAGGAGG + Intergenic
1200266745 X:154650250-154650272 AGAGAGGACGCTGAGACCTGGGG - Intergenic
1200784049 Y:7243434-7243456 ACTGAGGAGGCTGAGATAAGAGG - Intergenic
1200792041 Y:7308034-7308056 ACTCTGGAGGCTGAGACACGAGG - Intergenic
1201175705 Y:11307420-11307442 AGGGAGCAGGGTGATACCCGTGG - Intergenic
1201544181 Y:15142593-15142615 AGGTGGGAGGCTGAGAGAGGGGG - Intergenic