ID: 1036668884

View in Genome Browser
Species Human (GRCh38)
Location 8:10766550-10766572
Sequence GGCCTGTTGGTTCAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 288}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668884_1036668900 13 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668884_1036668895 6 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG No data
1036668884_1036668896 7 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG No data
1036668884_1036668894 5 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG No data
1036668884_1036668899 12 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data
1036668884_1036668897 8 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668897 8:10766581-10766603 GGCTTCTTTCCCTCAGCTGGGGG No data
1036668884_1036668898 11 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668884 Original CRISPR GGCCTGTTGGTTCAGGGAGG AGG (reversed) Intronic
900169309 1:1258582-1258604 GGCCCGTGGGTGCAGGGTGGGGG - Intronic
900485492 1:2920766-2920788 GGCCTGTTAGTTCAGGTGTGTGG - Intergenic
900570037 1:3353645-3353667 AGCCTGTGGGTGCAGTGAGGTGG - Intronic
902253510 1:15171809-15171831 CACCTGTGGGTTCAAGGAGGAGG - Intronic
902375210 1:16027212-16027234 GGACAGATGGCTCAGGGAGGAGG + Intronic
902380176 1:16049022-16049044 GGACAGATGGGTCAGGGAGGAGG + Intronic
902814321 1:18907610-18907632 GACCTCTGGGTTCAGGGCGGGGG - Exonic
904042862 1:27594280-27594302 GGCCTGGGGCTTCAGGGAGAGGG - Intronic
905506556 1:38484636-38484658 GGCCTGTGGGTCCATGGTGGGGG + Intergenic
906606709 1:47177764-47177786 GGCCTGTTGGGGCAGGGGTGGGG + Intergenic
906659664 1:47573380-47573402 GGGCGGCTGGTCCAGGGAGGTGG + Intergenic
909334157 1:74451237-74451259 GGCCTGTTGGGGAAGGCAGGGGG + Intronic
909588536 1:77319072-77319094 GGCCTATAGGTTCAAGGAGGAGG + Intronic
909749964 1:79147114-79147136 GGCCTGTTGCGGGAGGGAGGCGG - Intergenic
910263328 1:85312774-85312796 GGCCTGTTGGGTCGGGGGGTGGG - Intergenic
912519556 1:110235675-110235697 GGCCTGCTGTTTCTGTGAGGTGG - Intronic
913101706 1:115573659-115573681 GGGCTGTTGCTTCAGCGAGTGGG + Intergenic
913352054 1:117872678-117872700 GGCCTGTTGGGGGAGGGTGGGGG + Intronic
915019834 1:152768842-152768864 GGCCTGTTTGATGAAGGAGGTGG + Intronic
915281168 1:154822993-154823015 GGCATGCTGGTGCAGAGAGGTGG - Intronic
916865919 1:168858523-168858545 GGCCTGTTGGGTGAGGTATGAGG + Intergenic
920371339 1:205481196-205481218 GAACTGTTGCTTCAGGGAGGAGG - Intergenic
920536144 1:206737745-206737767 GGCCTGTGGGTACAGGGAAAGGG - Intergenic
921058542 1:211563351-211563373 GGCCTGCAGGGTCAGTGAGGTGG + Intergenic
922677945 1:227564150-227564172 GGCTTGTGGGTTTATGGAGGAGG + Intronic
922754672 1:228089090-228089112 TGCCTGTTGGGTTTGGGAGGGGG + Intronic
1063630601 10:7730366-7730388 GGCCTTTTTGTTCAGGGGGTAGG - Intronic
1064055975 10:12097824-12097846 GGCCTGCAGGTTCAGGGCAGGGG - Exonic
1064778896 10:18810891-18810913 GGCCTGTTGGTGGGGGGTGGGGG + Intergenic
1066212414 10:33252683-33252705 TGCCTGTTGGTTTGGGGATGTGG + Intronic
1067189063 10:44054563-44054585 AGCCTTGTGGTTCAGGGAGGAGG - Intergenic
1068245929 10:54367647-54367669 GGCCTGTTGGGGGAGTGAGGGGG + Intronic
1070091814 10:73294230-73294252 GGAGTGTTGGTTCTGGGAGTGGG - Intronic
1070126412 10:73625781-73625803 GTCCTGTGGGTACAGGGACGCGG - Intronic
1070355190 10:75632951-75632973 TCCCTGTGGGTTAAGGGAGGGGG + Intronic
1071599989 10:86954364-86954386 TCACTGTGGGTTCAGGGAGGAGG - Intronic
1072001709 10:91201582-91201604 GGGCTGTGGGTGGAGGGAGGAGG - Intronic
1072404998 10:95142800-95142822 GGCCTCTTGGAGCAGGGAGCTGG + Intergenic
1072611408 10:97019663-97019685 GGCCTGCTGTAGCAGGGAGGTGG - Intronic
1072964962 10:99963989-99964011 GGCCTGTTGTTTGAGGGGGCAGG + Intronic
1073733375 10:106318210-106318232 GGCCTGTTGGGTCGGGGGGAGGG - Intergenic
1076117250 10:127908811-127908833 GGTCTGTTGGGGCAGGGAGGGGG - Intronic
1076524476 10:131102854-131102876 GGCCTGTTGTTGCTGGGAGAGGG - Intronic
1077234430 11:1473049-1473071 GCCCTGGTGGTGCTGGGAGGTGG - Intronic
1078292278 11:10024700-10024722 GGCTTGGGGGTACAGGGAGGAGG - Intronic
1080051359 11:27862337-27862359 TCCCTGATGGTTCAGGGAGAAGG + Intergenic
1080096055 11:28408147-28408169 GGCCTGTTGGTTCAGGGGGTGGG + Intergenic
1080404707 11:31968489-31968511 GGCCCCTCGCTTCAGGGAGGGGG - Intronic
1081596094 11:44460664-44460686 GGCCTGAAGGGGCAGGGAGGAGG + Intergenic
1082260426 11:50073369-50073391 GGCCTGTTGACTCAGCCAGGAGG + Intergenic
1083464489 11:62835925-62835947 GCCCTGATGGTTGGGGGAGGTGG - Intronic
1083541778 11:63516308-63516330 GGCCTGCTGGTTCATGCTGGTGG - Exonic
1084483001 11:69432808-69432830 GGGCTGTAGGGTCAGGAAGGGGG + Intergenic
1084916011 11:72429619-72429641 GGGCTGTTGGTTAAGGGCAGAGG - Intronic
1084939335 11:72604021-72604043 GGCCAGGTGGTCCAGGGATGTGG - Intronic
1085272628 11:75279289-75279311 GGCGTTGGGGTTCAGGGAGGAGG + Intronic
1087018192 11:93574961-93574983 GGCCTGGTGGTGGAGGGATGGGG + Intergenic
1089147323 11:116338852-116338874 GGCCTGTGGGTTGAGGGAAGGGG + Intergenic
1089235605 11:117022035-117022057 GGCCTGTTGTTACAGGTAGAAGG - Intronic
1090356424 11:126143505-126143527 GGCCTGTCGGGGCAGGGATGGGG - Intergenic
1091325807 11:134686590-134686612 GGCCTGAGGGTTCAGGGCTGGGG - Intergenic
1091782224 12:3221043-3221065 TGGCTGTTGGTACGGGGAGGAGG + Intronic
1092917507 12:13202030-13202052 GGCCTGTGTGTTGAGGGAGGAGG + Intronic
1093180807 12:15965451-15965473 GGCCTGTTGGGGGAGGGTGGAGG - Intronic
1095233141 12:39765877-39765899 GGCCTGTGGGGGCTGGGAGGAGG - Intronic
1095784024 12:46090584-46090606 GGCCTGTTGGATCTTAGAGGGGG - Intergenic
1097609107 12:61795571-61795593 GGCCTGTTGGGTGGGGGAGGAGG + Intronic
1097768995 12:63558448-63558470 GGCCTGTTGGTGGGGGGTGGGGG - Intergenic
1099005116 12:77226471-77226493 TTCCTCTTGCTTCAGGGAGGTGG + Intergenic
1099435692 12:82642617-82642639 GGCCTGTTGGTGGGGGTAGGGGG + Intergenic
1099768409 12:87020787-87020809 AGGCTGTTGGTTCAGGCAAGTGG - Intergenic
1101441926 12:104710256-104710278 GGCCTGTGGCTGCAGCGAGGAGG + Intronic
1103933500 12:124463200-124463222 AGCCTGTTGGTTCCGGGACAAGG - Intronic
1108094600 13:46887905-46887927 GGCCTGTTGGTGGGGGGAGGTGG + Intronic
1108756865 13:53513545-53513567 GGCTTGTTGGTGCAGTGAAGAGG + Intergenic
1109879302 13:68450683-68450705 GGGCTGTTGTTTCAGAGAGTGGG + Intergenic
1113280115 13:108779538-108779560 GGCCAGAAGCTTCAGGGAGGTGG + Intronic
1114241763 14:20874570-20874592 GGGCTGTTGGTACAGGGCAGTGG + Intergenic
1114248355 14:20935136-20935158 GGGCTGTTGGTACAGGGCAGTGG + Intergenic
1114388271 14:22278543-22278565 GGTCTTGTGGTTCAGGGAGAGGG - Intergenic
1115917361 14:38330923-38330945 GGCCTGTTAGGGCAGGGTGGCGG + Intergenic
1115949375 14:38702702-38702724 GGCCTGTTGGGAGAGGGTGGAGG - Intergenic
1118985927 14:70754817-70754839 TGCCTGTTGGTTGTGGGATGAGG - Intronic
1121087119 14:91155076-91155098 GGCCTGTGGACTCAGGGTGGAGG - Intronic
1121209744 14:92199402-92199424 GGCATGTGGGTGCAGGGAGGAGG - Intergenic
1122437708 14:101711134-101711156 GGCCCGGTGGTTGAGTGAGGGGG - Intergenic
1123044446 14:105504379-105504401 GCCCTGTAGTTTCAGGGAAGAGG + Intergenic
1123956426 15:25340728-25340750 GGCCAGTTGGTTGGGGCAGGGGG - Intronic
1124157043 15:27234999-27235021 GGCCTGTTGGCTGAGGGCGTGGG + Intronic
1126152991 15:45539850-45539872 GGCCTGTTGATTCAAGGTAGGGG - Intergenic
1126805828 15:52348436-52348458 GGCTTGTTGGTTAAGGGTGAAGG - Intronic
1127093558 15:55490603-55490625 GGACAGTTGTTTCAGGGAGAGGG - Intronic
1128199364 15:65791901-65791923 GGCGGGTGGGTTCGGGGAGGAGG - Intronic
1128578088 15:68789849-68789871 TTCCTGTTGGGTCTGGGAGGGGG + Intronic
1129066100 15:72905262-72905284 GGCATGCTGGTTAAGGCAGGAGG + Intergenic
1129155095 15:73712679-73712701 GGCCTGTGGGTACTGAGAGGGGG + Intronic
1129737375 15:77973856-77973878 GGACTGTTGGTGCCGGGATGAGG + Intergenic
1129848697 15:78779769-78779791 GGACTGTTGGTGCTGGGATGAGG - Intronic
1130253221 15:82314177-82314199 GGACTGTTGGTGCCGGGATGAGG + Intergenic
1130300900 15:82679571-82679593 GAGCTGTTTGTTCAGGGAGCTGG - Intronic
1132108906 15:99087739-99087761 GGCCTGGGGGTTCAGGGTGGAGG + Intergenic
1133318600 16:4899188-4899210 GGCCTGGGGCATCAGGGAGGAGG - Intronic
1133699717 16:8297635-8297657 GTGCTGTTGTTTCGGGGAGGGGG + Intergenic
1134080849 16:11323894-11323916 GGCCTGTTTCTTCTGGGAGATGG + Intronic
1134869686 16:17640598-17640620 GGCCTGTTGGGGGAGGGTGGAGG - Intergenic
1135491885 16:22916427-22916449 GGTCTGGGGGGTCAGGGAGGAGG + Intergenic
1135506718 16:23044258-23044280 GGGCTGTGGGTTGGGGGAGGAGG - Intergenic
1137271396 16:46904661-46904683 GGCCTGGGTGTTCAGGGAAGTGG + Intronic
1141161693 16:81633379-81633401 GGCCTGTTGGCTCGGAGATGAGG + Intronic
1142002642 16:87672176-87672198 GGCCTGTAGGTGAGGGGAGGCGG + Intronic
1142270868 16:89088685-89088707 GGGGGGTTGGATCAGGGAGGGGG + Intronic
1142270882 16:89088723-89088745 GGGGGGTTGGATCAGGGAGGGGG + Intronic
1142270895 16:89088760-89088782 GGGGGGTTGGATCAGGGAGGGGG + Intronic
1142299141 16:89246674-89246696 GGCCTGTTGGGGGAGGGCGGGGG + Intergenic
1142469490 17:155458-155480 GGGCAGGTGCTTCAGGGAGGGGG - Intronic
1142802193 17:2353257-2353279 ATCCTGTTTGTTGAGGGAGGAGG + Intronic
1143098767 17:4493196-4493218 GGTCTGTTGGTGAAGGGCGGGGG + Intergenic
1143108293 17:4540330-4540352 GTCCAGTAGGTTCTGGGAGGGGG - Exonic
1143416259 17:6753132-6753154 GGCCTGTGGGTCAGGGGAGGGGG - Intergenic
1143780193 17:9225304-9225326 AGCCTGTGTGTTCAGGCAGGAGG + Intronic
1143834351 17:9678188-9678210 GATGTGTTGGTTCAGGGAGATGG + Intronic
1146442920 17:32912770-32912792 GGCCTGTTGGTGCTGGGTGTGGG + Intergenic
1147586794 17:41657557-41657579 GGCCGGGTGGTTTAAGGAGGTGG - Intergenic
1147605159 17:41770263-41770285 GGGCTGTGGGTTCAGAGAGCAGG + Intronic
1148901656 17:50883195-50883217 GGCGTGGTGGTCCAGGGAGGAGG - Intergenic
1149640353 17:58198856-58198878 GGCCTGTGGTGTTAGGGAGGAGG + Intronic
1151602534 17:75115079-75115101 GGCCTTTTGGCCTAGGGAGGAGG + Intronic
1151728935 17:75899663-75899685 GGGATGTTGGTTCTGGGAGGAGG + Exonic
1153736634 18:8077387-8077409 GGCTAGTTGGGTCAGGGAAGGGG - Intronic
1156073858 18:33248418-33248440 GGCCTGTTGGGTGAGGGAAGGGG - Intronic
1156971941 18:43167182-43167204 TGCCAGTTTGTTCAGGGAGAGGG - Intergenic
1157955230 18:52089558-52089580 GGCCTGCTGCTTCAGGGAGATGG - Intergenic
1158264943 18:55651455-55651477 GGCCTGTTGGTCTGAGGAGGAGG + Intronic
1159172156 18:64784877-64784899 GACCTGTTGGGGGAGGGAGGGGG + Intergenic
1161110473 19:2466775-2466797 GGCCTTCAGGTTGAGGGAGGAGG + Intergenic
1161112838 19:2479394-2479416 TCCCTGTTGGTTCAGGGCTGTGG - Intergenic
1161716196 19:5877390-5877412 GACCTGGTGGTGCAGGGTGGTGG - Intronic
1162182895 19:8882802-8882824 GGCCTGTGGGGTCAGGGCGGTGG + Exonic
1162329972 19:10021770-10021792 GGTCTGGTTGTTCAGGGATGGGG - Exonic
1162413648 19:10521004-10521026 GGCCTGTGGGGTGTGGGAGGAGG - Intergenic
1162833199 19:13299573-13299595 GGCCTTCTGGGTCAGGGGGGAGG - Intronic
1162932263 19:13963004-13963026 GTCCAGGGGGTTCAGGGAGGTGG + Exonic
1164521987 19:28986378-28986400 AGCCAGCTGGTTCAGGGATGGGG + Intergenic
1164680740 19:30132224-30132246 GCCCTGTTGGTACAAGGAGGAGG - Intergenic
1164752543 19:30667367-30667389 GGCCCTTGGGTGCAGGGAGGGGG + Intronic
1165938525 19:39403512-39403534 GGTCTGTGGGTTTGGGGAGGTGG + Intergenic
1166253706 19:41587667-41587689 GGCCTGTGGGTCCAGGTAGAGGG - Intronic
1166351385 19:42200019-42200041 GGCTTGTTGGAGCAGTGAGGAGG - Intronic
1166596144 19:44051948-44051970 GGCCCTTTGGCTCAGGGGGGCGG + Intronic
1168092542 19:54095535-54095557 GGACTGCTGGATCAGGAAGGAGG + Exonic
1168097554 19:54124272-54124294 GGCCTGGGGGTGCAGGGAGGAGG - Intronic
926331686 2:11830757-11830779 TGCTTGTTGGTTGAGTGAGGCGG + Intergenic
926918303 2:17914600-17914622 GTCTTGTTGGCTCAGGGAAGAGG + Intronic
927787031 2:25981501-25981523 GTACTGTTGGTTCTGGGAGCGGG + Exonic
929572635 2:43032278-43032300 GGGCTGTTGGCTTTGGGAGGTGG + Intergenic
929867976 2:45734610-45734632 GTCCTGTTGCTCCAGGAAGGCGG - Intronic
930798230 2:55415365-55415387 CCCCAGTTGTTTCAGGGAGGAGG - Intronic
931885162 2:66609423-66609445 GGCCCATTGGTTCAGGGATGTGG + Intergenic
933702383 2:85264699-85264721 GGCTAGTTGGGTTAGGGAGGAGG - Intronic
933877448 2:86633213-86633235 GGCCTGTGGCTGGAGGGAGGGGG - Intronic
934112452 2:88756344-88756366 TGCCAGTGGGGTCAGGGAGGAGG - Intergenic
936479109 2:112868693-112868715 AGGGTTTTGGTTCAGGGAGGAGG + Intergenic
938227520 2:129628511-129628533 GGGCTGGAGGTTCATGGAGGCGG + Intergenic
939941264 2:148354265-148354287 GGCCTGTTGGTGGGGGGTGGAGG - Intronic
939981686 2:148790171-148790193 GGCCTGTTGGGGAAGGGTGGGGG - Intergenic
945592924 2:211756102-211756124 TGTGTGTGGGTTCAGGGAGGGGG + Intronic
948094237 2:235320948-235320970 GTGCTGCTGCTTCAGGGAGGAGG + Intergenic
948909579 2:240996369-240996391 GGCCTGTTTCTTCAGGCGGGTGG - Intergenic
1169066636 20:2697700-2697722 GTCCTGTTGGCTCAGGGCAGGGG - Intronic
1169464781 20:5827534-5827556 GGCCTGTGGGTGAAGGCAGGTGG - Intronic
1171400544 20:24870765-24870787 GGTCGGTAGGTCCAGGGAGGAGG - Intergenic
1171490028 20:25510339-25510361 GCCCTGTGGTTTCAGGCAGGAGG - Intronic
1172807516 20:37623006-37623028 AGCCTGCTGGTCCTGGGAGGAGG + Intergenic
1172833915 20:37860162-37860184 AGCCTTTTGTTTCAGGGATGGGG + Intronic
1172858580 20:38028631-38028653 GTCCTGTTGGTTGATGGTGGTGG - Intronic
1175885735 20:62289447-62289469 TGCCTGTTTGTTTAGGGAGAGGG - Intronic
1179390353 21:40983358-40983380 GGGCTGTTGGTTGAGGGGTGAGG - Intergenic
1179937013 21:44612429-44612451 GGCCTGTTGGCAGGGGGAGGAGG - Exonic
1181821015 22:25475764-25475786 GGCTGGCTGGTTCAGGGAGTGGG - Intergenic
1182066630 22:27435827-27435849 GGCCTGGTGGTCCCGGGTGGGGG - Intergenic
1182611395 22:31550607-31550629 GGCCTGCTGGTTCAGTGGGCTGG + Intronic
1182944137 22:34306107-34306129 GGGCTGTTGGATGAAGGAGGGGG + Intergenic
1183095879 22:35552057-35552079 GGCCAGTGCCTTCAGGGAGGTGG + Exonic
1183175145 22:36218213-36218235 GGCCTGTTGGCGCAGGGGGAGGG - Intergenic
1183253643 22:36746891-36746913 AGGGTGTTGGTTGAGGGAGGGGG - Intergenic
1183544035 22:38446241-38446263 AGCCTGTTGTCTCAGGGAGCCGG + Intronic
1183614301 22:38934004-38934026 CTGCTGTTGCTTCAGGGAGGTGG - Intergenic
1184212225 22:43042857-43042879 GGACGGCTGGATCAGGGAGGGGG + Intronic
1184246124 22:43236617-43236639 GGCCTGTGGGTTCAAGGACCTGG - Intronic
1184344902 22:43907306-43907328 TGCCTGTTGGTTCAGAGGGTTGG + Intergenic
1185245577 22:49771221-49771243 GGCGTGTTGGTTCGGGGAGTTGG - Intergenic
1185319428 22:50193694-50193716 GGGCTGTTGAGTCAGGGAGGAGG + Intronic
949108993 3:235927-235949 GGCCTCTGGCTTCTGGGAGGTGG + Intronic
949898752 3:8792646-8792668 GGCCAGCAGGATCAGGGAGGAGG - Intronic
950567165 3:13776737-13776759 GGCCAGCTGCTTCAGGGAGATGG - Intergenic
952537317 3:34324598-34324620 GCCCTGTTTGTTCAGTCAGGAGG - Intergenic
952573410 3:34744914-34744936 GACTTGTTGGTTTAGGTAGGTGG - Intergenic
952721461 3:36537533-36537555 GGCCTGTTGGGGCAGGGGCGTGG + Intronic
952956148 3:38558807-38558829 GGCCTCTTGGTACAGGGAGCTGG - Intronic
953810606 3:46109340-46109362 GGCTTGCTGGCCCAGGGAGGGGG - Intergenic
954199326 3:49014834-49014856 GGCCTGGAGAGTCAGGGAGGGGG - Exonic
954274993 3:49536187-49536209 GGCCTGTAGGTTCTGGGGGTTGG + Intergenic
954991977 3:54849384-54849406 GGACTGGTGGTTAAGGAAGGAGG - Intronic
954997653 3:54896215-54896237 GGCCTGTTTGTCCAGCGAGGAGG + Intronic
955589328 3:60517465-60517487 CGCCTGTAGTTTTAGGGAGGTGG - Intronic
960394605 3:117120947-117120969 TGCCTGTTGGTTCTGAGAGATGG + Intronic
961108030 3:124258841-124258863 GACCTGCTGATTCAGAGAGGTGG + Intronic
964903175 3:161685889-161685911 GGCTGTTTGGTTCATGGAGGTGG + Intergenic
968728517 4:2259237-2259259 GGCCTGTTGGTGCAGCGGGTGGG - Intronic
971985381 4:33815498-33815520 TTACTGTTTGTTCAGGGAGGTGG - Intergenic
973228638 4:47816682-47816704 TGTCTGTTGGTTGAAGGAGGAGG + Intronic
976480233 4:85534524-85534546 GGCTTGTTGGTTGGGGGAGAAGG + Intronic
978272636 4:106909074-106909096 GGCCTGTTTCTTCAGGGATTTGG - Intergenic
979346509 4:119593568-119593590 GAGCTGTGGGTTAAGGGAGGAGG + Intronic
981594362 4:146402526-146402548 GGCCTGTGGGGTCAGGGCTGAGG - Intronic
982222710 4:153138426-153138448 GGCCTGTGGGTTCTGGTTGGTGG + Intergenic
983018325 4:162642230-162642252 GGCATGTGGATTCAGGGAAGAGG + Intergenic
984854620 4:184184066-184184088 GTCCAGTTGGTGCATGGAGGTGG - Intronic
985228541 4:187789440-187789462 AGTCTGTTGGTTGAGGGGGGCGG - Intergenic
985647315 5:1091041-1091063 GGCCTGTTGTTTGACGGTGGCGG - Intronic
986733849 5:10653878-10653900 TGCCATGTGGTTCAGGGAGGAGG + Intergenic
987738365 5:21873785-21873807 GGCCTGTTGGGGGAGGGTGGGGG - Intronic
990988361 5:61661731-61661753 AGGCTGTTGGTTTAGGAAGGGGG + Intronic
994972231 5:106755448-106755470 GGCCTGTTCCTTCTGGGAGAAGG - Intergenic
995939751 5:117567439-117567461 GGCCTGTTGGGTGATGGAGTTGG + Intergenic
997641588 5:135452142-135452164 GGCCTGGTGGGGCTGGGAGGAGG - Intronic
999389276 5:151178406-151178428 GGAGTGTTGGGGCAGGGAGGTGG + Intergenic
999491464 5:152055500-152055522 GGAGTGTTGGGGCAGGGAGGTGG + Intergenic
1000345067 5:160307645-160307667 CTCCTTTTGGTTCAGGGAAGAGG + Intronic
1000528947 5:162393916-162393938 ACCCTGTTGGTTTTGGGAGGGGG + Intergenic
1001557884 5:172648619-172648641 GGAATGTTGGGTCAGGGTGGAGG + Intronic
1002101441 5:176860076-176860098 GGCGTGTGGGGGCAGGGAGGGGG - Intronic
1002280115 5:178124861-178124883 GGGCTGTGGGCGCAGGGAGGAGG - Exonic
1002280445 5:178126892-178126914 GGCCTGAGGTTTCTGGGAGGAGG - Intergenic
1002421229 5:179150137-179150159 GGCATGCTGGTTCAGGGAGCAGG - Intronic
1002757558 6:176826-176848 CGCCCGTTGGTTCCTGGAGGTGG + Intergenic
1003403553 6:5810162-5810184 GGCCTGGTGGGGCTGGGAGGTGG + Intergenic
1005852551 6:29832626-29832648 GGGCTGTGGGTACAGGGAGGTGG + Intergenic
1005858539 6:29883484-29883506 GGCCTATTGGGGCAGGGTGGTGG + Intergenic
1005863674 6:29922047-29922069 GGCCTGTTGGGGGAGGGCGGTGG + Intergenic
1005981909 6:30843260-30843282 GGCCTGGTGGTGCACGGATGTGG - Intergenic
1006725332 6:36196235-36196257 GGCCCTTTAGTTCGGGGAGGGGG + Intergenic
1006748256 6:36360398-36360420 GGCCTGTGGGTTAGGAGAGGAGG + Intronic
1007971953 6:46060898-46060920 GACCAGTTGGTTCAGGAAGAAGG - Intronic
1012917688 6:105188324-105188346 GGCCTGGTGGTTAAGTGGGGTGG + Intergenic
1015938242 6:138424165-138424187 GGCCTGGGGCTGCAGGGAGGCGG + Exonic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1016744611 6:147565302-147565324 GGCCTGTGGGGGCCGGGAGGTGG + Exonic
1017082176 6:150680563-150680585 GGGATGTTGGTACAGGGAGGTGG + Intronic
1018813956 6:167317235-167317257 GGCCTGGCTGATCAGGGAGGAGG + Intergenic
1018923429 6:168191075-168191097 CTCATGCTGGTTCAGGGAGGTGG + Intergenic
1019517070 7:1444822-1444844 GGCCTGCTGGGTCCTGGAGGCGG + Exonic
1019656309 7:2197947-2197969 GCCCTGTGGGTGCAGGGAGATGG - Intronic
1019744892 7:2694143-2694165 GGACAGTGGGTTCAGGAAGGTGG + Intronic
1019761161 7:2813889-2813911 GGACAGTGGGTTCAGGAAGGTGG + Intronic
1020084757 7:5304179-5304201 GGCCGGGTGGATCAGGGAGCAGG + Exonic
1020220634 7:6234013-6234035 GGCCTGATGGTACTAGGAGGTGG - Intronic
1020257610 7:6510754-6510776 GGCATGTTGGTTCTGGGCCGGGG - Intronic
1024565889 7:50680580-50680602 GGCCTGTGGGTCCTGGGAGTCGG - Intronic
1025004157 7:55342484-55342506 GGCCTGTTGCTTCCGGGAGCTGG - Intergenic
1025209548 7:57013021-57013043 GGCCGGGTGGATCAGGGAGCAGG - Intergenic
1025662400 7:63563829-63563851 GGCCGGGTGGATCAGGGAGCAGG + Intergenic
1026462684 7:70628893-70628915 GGCCTGATGGAACAGGGAGGGGG + Intronic
1027514010 7:79118760-79118782 GGCCAGTGGAATCAGGGAGGAGG - Intronic
1027734616 7:81916911-81916933 GGCCTGTTGGTGTAGGGGCGAGG - Intergenic
1031096449 7:117426598-117426620 GGCCTCTTGCTTGAAGGAGGGGG + Intronic
1033272745 7:139947405-139947427 GGCCTGTTGGGGGAGGGGGGAGG + Intronic
1033315554 7:140294405-140294427 GGCCAGCTGCTTCAGGGTGGTGG + Intronic
1035283361 7:157791575-157791597 GGCAGGTGGGTGCAGGGAGGGGG - Intronic
1035652914 8:1282217-1282239 GTCCTGATGGTTCAGGGGGCTGG - Intergenic
1036668884 8:10766550-10766572 GGCCTGTTGGTTCAGGGAGGAGG - Intronic
1040606579 8:48939232-48939254 GGCCTGTCGGTGAGGGGAGGGGG - Intergenic
1041384215 8:57280787-57280809 GGCTTGGGGGTTGAGGGAGGAGG + Intergenic
1042581691 8:70286270-70286292 GGCATGTTGACTGAGGGAGGAGG + Intronic
1044115023 8:88325468-88325490 GGCCTATTGCTTCAGGTTGGTGG - Intronic
1046116104 8:109785552-109785574 AGCCTGTTGGGGCAGGGCGGTGG + Intergenic
1046926324 8:119793019-119793041 GGCATATTGGTTAAGGCAGGAGG + Intronic
1048529614 8:135235471-135235493 GCACAGTTGGTACAGGGAGGAGG - Intergenic
1049007638 8:139865713-139865735 ACCCAGTTGGTCCAGGGAGGGGG + Intronic
1049601688 8:143510702-143510724 GGCCTGTGTCCTCAGGGAGGAGG - Intronic
1049879405 8:145052138-145052160 GGCCTGGGGGTTCGGGGAAGAGG - Intergenic
1051249594 9:15145995-15146017 GGCCTGTTGGAAGAAGGAGGAGG - Intergenic
1051719819 9:20024969-20024991 GGCCTGGTGGTCTAGGGAAGAGG - Intergenic
1053125655 9:35578733-35578755 GGTATCTTGGTTCTGGGAGGTGG + Intergenic
1053304221 9:36972634-36972656 GGCCTGTTGGTTGGGGGTGGTGG + Intronic
1055411264 9:76032183-76032205 GGTCTGATTGTTCAGTGAGGAGG - Intronic
1056870109 9:90269266-90269288 GGACTGTTGGGAGAGGGAGGAGG - Intergenic
1057078733 9:92155917-92155939 GGCCTGTTGTTGCTGGGAGAGGG - Intergenic
1057158174 9:92863257-92863279 GGCCTGTTGGGGAAGGGTGGGGG + Intronic
1057376715 9:94531031-94531053 GGCCTGTTGGGTGATGGAGTAGG + Intergenic
1057855880 9:98600381-98600403 GGTCTGGAGCTTCAGGGAGGTGG - Intronic
1059638893 9:116196794-116196816 GGCCTGGTGGTGAAGGGTGGAGG + Intronic
1060183595 9:121550702-121550724 GGACTGTTGTGGCAGGGAGGGGG + Intergenic
1060212396 9:121718513-121718535 GGCCTGGTGGCTCAGGGGAGTGG - Intronic
1061048890 9:128182565-128182587 GGCCCGTTTGTGCAGGGAAGGGG - Intronic
1061059622 9:128243911-128243933 GGGCTGTGGGTGCTGGGAGGCGG + Intronic
1061250507 9:129423548-129423570 GGCGTGTTGCTAGAGGGAGGAGG - Intergenic
1061273609 9:129557647-129557669 GGCGTGTTTGTTCAGGCTGGAGG - Intergenic
1062212506 9:135372558-135372580 GGCCTGGCGCTGCAGGGAGGAGG - Intergenic
1062452444 9:136621276-136621298 GACCTGCTGGTTCTGGGAGGCGG + Intergenic
1062580160 9:137225848-137225870 GGCCTGCTGGTTCTGGATGGGGG - Exonic
1186232740 X:7473286-7473308 GGCCTGAAGTTTCATGGAGGAGG - Intergenic
1187341745 X:18426382-18426404 GACCTGTTCGTTCTGGGAGACGG - Intronic
1189011210 X:37047438-37047460 AGTCTGTTGGTGCAGGGTGGGGG + Intergenic
1191588265 X:62852292-62852314 AGCCAGTTGCTTCAGGGTGGTGG - Intergenic
1192807627 X:74524250-74524272 GGGCTGTGGGTTAAGGGCGGAGG + Intronic
1195205511 X:102595838-102595860 GGCCTCTTGGTACAGGGAGCAGG - Intergenic
1195600682 X:106744094-106744116 GGCCTGTTGGGTGGGGGAAGGGG + Intronic
1195966290 X:110432921-110432943 GACCCTGTGGTTCAGGGAGGTGG + Intronic
1196351675 X:114738628-114738650 GGCCTGTTGGGGCATAGAGGGGG + Intronic
1196894263 X:120319439-120319461 GGCTTGTTGGTGCTGGCAGGTGG + Intergenic
1197645158 X:129009519-129009541 TGCCTGTTGTATCTGGGAGGGGG - Intergenic
1199150452 X:144478916-144478938 GGCCTGTTGGTTGGGGTAGAAGG + Intergenic
1199600173 X:149536990-149537012 GGGCTGTGGTTTCAGGAAGGAGG + Intergenic
1199650410 X:149942950-149942972 GGGCTGTGGTTTCAGGAAGGAGG - Intergenic
1200917691 Y:8585749-8585771 GGCTTGTTGGTTCTGGCAGTGGG + Intergenic
1200986404 Y:9306406-9306428 GGGCTGTGGGTTCAGGTAGATGG + Intergenic
1201009004 Y:9531914-9531936 AGCATGTTGTTTCAGGGAAGAGG + Intergenic
1202124174 Y:21554496-21554518 GGGCTGTGGGTTCAGGTAGATGG - Intergenic
1202154834 Y:21874884-21874906 GGGCTGTGGGTTCAGGTAGATGG + Intergenic