ID: 1036668885

View in Genome Browser
Species Human (GRCh38)
Location 8:10766553-10766575
Sequence GCTGGCCTGTTGGTTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668885_1036668898 8 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data
1036668885_1036668894 2 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG No data
1036668885_1036668896 4 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG No data
1036668885_1036668900 10 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668885_1036668897 5 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668897 8:10766581-10766603 GGCTTCTTTCCCTCAGCTGGGGG No data
1036668885_1036668895 3 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG No data
1036668885_1036668899 9 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668885 Original CRISPR GCTGGCCTGTTGGTTCAGGG AGG (reversed) Intronic
900546962 1:3234650-3234672 CCTGGCCTGTGGGTGGAGGGTGG - Intronic
900572595 1:3366052-3366074 ACTGGCCTGTGGGGCCAGGGAGG + Intronic
901392605 1:8956855-8956877 TCTGGCCTGTTGGTTCTGGGCGG + Intronic
902251395 1:15155978-15156000 GCTGGCCTGTGGGTTGGTGGGGG + Intronic
904043543 1:27597671-27597693 GCTGGCCTGGGGGTTTGGGGAGG + Intronic
905914199 1:41673905-41673927 GCTGGGGTGGGGGTTCAGGGAGG - Intronic
906588508 1:47001743-47001765 GCTGGACTGTGGCTTCAGTGTGG - Intergenic
909049666 1:70752923-70752945 GCTGGAGTGATGGCTCAGGGAGG + Intergenic
910617871 1:89219319-89219341 GCTGGGCTTCTGGTTCAGGTGGG - Intergenic
916011841 1:160713133-160713155 GCTTGCCTGTGGGTCCTGGGTGG - Intergenic
918322425 1:183376982-183377004 GCTCCCCTCTTGGTTCTGGGTGG + Intronic
922696141 1:227731979-227732001 TCTGCCCTGTGGGTTCAGGGAGG - Exonic
924824726 1:247527256-247527278 GCTGTCCTCATGGTTCTGGGAGG + Intronic
1068576359 10:58688473-58688495 GCTGGGCTTCTGGGTCAGGGGGG - Intronic
1070689303 10:78512758-78512780 GCTAGCCTGCTGGTCCAAGGAGG + Intergenic
1071271266 10:84009824-84009846 ACTGGGCTGCTGGTTCAGAGAGG - Intergenic
1075645747 10:124094746-124094768 GGTGGACTGTAGCTTCAGGGGGG - Intergenic
1076695947 10:132247491-132247513 GCTGGCCTGAAGGCGCAGGGTGG + Intronic
1078186561 11:9056589-9056611 GCTAGCCTCCTGGTTCAGTGTGG + Intronic
1078874305 11:15378229-15378251 GCTGGGCTGTAAGTTCTGGGTGG + Intergenic
1080393090 11:31865984-31866006 GCTGGCCTGTAGAATGAGGGAGG + Intronic
1083913451 11:65724483-65724505 GATTGCCTGTTGGTACAGTGAGG + Intergenic
1088685287 11:112280009-112280031 GGTGGTCTTTTGGTTGAGGGTGG + Intergenic
1099311297 12:81027978-81028000 GCTAGCTTGCTGGTCCAGGGAGG - Intronic
1100550265 12:95640407-95640429 GCTGGCCTGTTGGTCCCAGGAGG + Intergenic
1101441925 12:104710253-104710275 GCTGGCCTGTGGCTGCAGCGAGG + Intronic
1101987660 12:109460443-109460465 GGTGGCCTGCTGTTCCAGGGAGG + Intronic
1102007163 12:109596293-109596315 TATGGCCTGTTGGCTCAGGTGGG + Intronic
1103936297 12:124479046-124479068 TCTGGCCTGTGGGTTCTGGAGGG - Intronic
1104182704 12:126398133-126398155 GCTGGGATGGTGGTGCAGGGGGG + Intergenic
1104377601 12:128278568-128278590 GGTTGCCTGTTAGTTCTGGGTGG + Intronic
1104946996 12:132419716-132419738 GCTGCCCTGTGGGTTCAGGCTGG - Intergenic
1106243598 13:27928521-27928543 ACTGGCCAGTTGGCTGAGGGTGG - Intergenic
1112400789 13:99076803-99076825 CCTGGACTGTTGGTTCACCGTGG - Intronic
1114785974 14:25599529-25599551 GCTGGCCTTCTGGGTCAGGTGGG + Intergenic
1118614774 14:67567794-67567816 AATGCCCTGTTGGCTCAGGGAGG - Intronic
1125331874 15:38590323-38590345 CCTGGTCTGGTGGTTTAGGGAGG + Intergenic
1125409750 15:39393634-39393656 GCTGGCCTGTTTGTTCTCTGTGG - Intergenic
1128985929 15:72221205-72221227 GCTCCCCTTTTGGCTCAGGGTGG + Intronic
1131972204 15:97904089-97904111 GGTGGCCTGTTGGTTCAGCGAGG + Intergenic
1132108905 15:99087736-99087758 CCTGGCCTGGGGGTTCAGGGTGG + Intergenic
1132601040 16:773099-773121 GCTGGGCTGTGGGGACAGGGAGG - Intronic
1132925063 16:2424922-2424944 GCTGGGCTGGAGGATCAGGGAGG - Intergenic
1133758944 16:8782542-8782564 AGTGGCCTGTTGGTTCAACGTGG + Exonic
1135646716 16:24169300-24169322 GCTGGGCTGTTGGTACACAGCGG + Intronic
1136116438 16:28097670-28097692 GTTGGCCTGGTGGTGGAGGGAGG - Intergenic
1139350576 16:66332572-66332594 TCTGGCCCTTTGGTTTAGGGAGG - Intergenic
1141202824 16:81910784-81910806 GCTGGCCTGGTGGTTCAGCCGGG + Intronic
1142358707 16:89616162-89616184 GCTGGGCTGGGGGTTCAGGTGGG + Intronic
1143814348 17:9499780-9499802 GCTGGCCTGTGGGGTGTGGGTGG - Intronic
1144043209 17:11431146-11431168 GCTGGGCTGATGACTCAGGGGGG - Intronic
1144667412 17:17111504-17111526 GCTGGCCTGTGTGTCCAGGGGGG + Intronic
1144759364 17:17698634-17698656 GCTGGCCTGGGGGTGCAGGCAGG - Intronic
1146527581 17:33580064-33580086 GCTGGCCTTCTGGGTCAGGTGGG - Intronic
1146906494 17:36621564-36621586 GCTGGGCTGGTGGTTGTGGGGGG - Intergenic
1148901657 17:50883198-50883220 GCTGGCGTGGTGGTCCAGGGAGG - Intergenic
1149310866 17:55391694-55391716 GCTGACCTGTTGCATCTGGGGGG + Intergenic
1149342608 17:55702038-55702060 GCTGGGCTTCTGGTTCAGGTGGG + Intergenic
1150201521 17:63362364-63362386 GCTGGGCTGTCAGTTCTGGGTGG - Intronic
1150414402 17:64975526-64975548 CGAGGCCTGTTGGGTCAGGGCGG - Intergenic
1151967878 17:77441086-77441108 GCTGGGCTCCTGGTTCTGGGAGG + Intronic
1151969422 17:77450226-77450248 GCTGGCCTGTTTGGCCAGTGTGG + Intronic
1152639147 17:81442497-81442519 GCTGGCCTTTAGGTCCCGGGGGG - Exonic
1152654057 17:81511921-81511943 GTTGGCCTTGGGGTTCAGGGGGG + Exonic
1153753483 18:8257299-8257321 GCTGGTCTGTGGGATGAGGGTGG + Intronic
1155438954 18:25841767-25841789 GATGCCCTGTGTGTTCAGGGTGG - Intergenic
1158264942 18:55651452-55651474 GCTGGCCTGTTGGTCTGAGGAGG + Intronic
1161268038 19:3374166-3374188 GCTGGCCTGGACTTTCAGGGTGG + Intronic
1161576534 19:5057697-5057719 GCTGCCCTGTGGGATCAGGAGGG + Intronic
1162259211 19:9518788-9518810 GCTGGCCTTGGGGTTCAAGGGGG - Intergenic
1162568447 19:11457225-11457247 GCAGGCCTGTTGGGTGGGGGTGG - Intronic
1163034059 19:14561466-14561488 ACTGGCCTGGGGGCTCAGGGAGG + Intronic
1163390134 19:17025982-17026004 GCAGGGCTGCGGGTTCAGGGGGG - Intronic
1164985131 19:32642909-32642931 GCTGGCGTGCTGGTGCAGTGTGG + Intronic
1166380677 19:42353671-42353693 GCTGGCCCGTTGGCTCACCGGGG - Exonic
1166392145 19:42414408-42414430 GCTGTTCTGCTGGCTCAGGGTGG + Intronic
1166936009 19:46333370-46333392 CCTGGCCTGAAGGTGCAGGGCGG + Intronic
1168097555 19:54124275-54124297 GCTGGCCTGGGGGTGCAGGGAGG - Intronic
1168350070 19:55670608-55670630 GGTGTACTGTTCGTTCAGGGTGG + Intronic
925210180 2:2038806-2038828 GCTGGGGTGTGGGTTCAGGATGG - Intronic
927515302 2:23668727-23668749 GCTGGCCTGGGGGATCAGGAGGG - Intronic
927790955 2:26009107-26009129 GCAGCTCTGTTGGTTCAGAGGGG + Intergenic
927906854 2:26864755-26864777 GCTGGCCTGTGAGAGCAGGGAGG + Intronic
927982348 2:27381879-27381901 GCTGGCTTGCTGAGTCAGGGTGG + Intronic
928171015 2:29002955-29002977 GCTGGCCTGGGGGCTCTGGGTGG + Intronic
932494799 2:72140961-72140983 GCTGGCCTCTTGGTGCACTGAGG + Intronic
937085673 2:119170281-119170303 GCTGGCCTGGTTGTTTTGGGGGG + Intergenic
937111209 2:119368013-119368035 GCTGCCCTGTTGGGGCAGGGAGG + Intronic
938282592 2:130075027-130075049 GTTGGCCTTAGGGTTCAGGGTGG + Exonic
938333223 2:130463599-130463621 GTTGGCCTTGGGGTTCAGGGGGG + Exonic
938356589 2:130657072-130657094 GTTGGCCTTGGGGTTCAGGGGGG - Exonic
938433021 2:131263878-131263900 GTTGGCCTTGGGGTTCAGGGGGG - Exonic
938477074 2:131626461-131626483 GTTGGCCTTGGGGTTCAGGGGGG - Intergenic
942902987 2:181145618-181145640 GCTGGGCTTTTGGGTCAGGTGGG - Intergenic
946413283 2:219526327-219526349 CCTGGCATGTTGGGTCAGGGTGG + Intronic
947991919 2:234495495-234495517 GGGGGCATGTTGGTTCTGGGGGG - Exonic
949044319 2:241864083-241864105 GTTGGGCTGTTTGTTAAGGGGGG + Intergenic
1168863047 20:1059876-1059898 CCTGTCCTGGTGGATCAGGGTGG + Intergenic
1172885631 20:38229028-38229050 TCTGGCCAGTGGGTACAGGGTGG + Intronic
1172901108 20:38335489-38335511 CCAGGCATGCTGGTTCAGGGAGG + Intronic
1173024904 20:39298778-39298800 GCTGGCCTGCTGGAGAAGGGCGG + Intergenic
1173072115 20:39778429-39778451 GATGGCATGATGGTTCAGGATGG + Intergenic
1173367740 20:42402450-42402472 GATGCCCTGTTTGCTCAGGGAGG + Intronic
1173801109 20:45895030-45895052 GCTGTTGTGTTGGTGCAGGGGGG - Exonic
1174064095 20:47852249-47852271 GGTGGCCTGGTGGTCCAGGGTGG + Intergenic
1174881421 20:54283334-54283356 TCTGGCCCATTGGTCCAGGGTGG - Intergenic
1175460420 20:59148262-59148284 GCTGGCCTCTCTGTTGAGGGGGG + Intergenic
1180143772 21:45908746-45908768 GCTGGGCTTTGGGTTCAGGCTGG - Intronic
1182282768 22:29226657-29226679 GCTGCCCTGTGGGTTCACTGAGG - Intronic
1182714878 22:32349982-32350004 GCTGACCTTTTTGTTGAGGGCGG - Intergenic
1185319427 22:50193691-50193713 GTTGGGCTGTTGAGTCAGGGAGG + Intronic
950550635 3:13663973-13663995 GCTGCCCCGATGGCTCAGGGTGG + Intergenic
950840730 3:15966067-15966089 GCTGGCGTGGTGGTGCAGGCTGG - Intergenic
952078488 3:29728195-29728217 GGGGGCCTGTTGGGGCAGGGGGG + Intronic
953917973 3:46932756-46932778 TCTGGCCTGTGGTTTCAGGTGGG - Intronic
954451912 3:50576245-50576267 CCTGGCCTGTGGTTTCATGGTGG - Intronic
954997652 3:54896212-54896234 GCAGGCCTGTTTGTCCAGCGAGG + Intronic
955318720 3:57959315-57959337 GCTGGCCTGTCGGTGATGGGTGG - Intergenic
958726470 3:97911271-97911293 GCAGGCCTGTCAGTGCAGGGTGG + Intronic
960587962 3:119337888-119337910 GCTGGGCTTCTGGGTCAGGGAGG - Intronic
961280139 3:125759920-125759942 GCTGGCATGAAGGTACAGGGAGG + Intergenic
961459824 3:127043170-127043192 GTTGGCCTGTGGTTTCATGGAGG - Intergenic
961602534 3:128072599-128072621 GCTGGCCTCAGGGCTCAGGGAGG + Intronic
964417917 3:156468995-156469017 GCTGCCCTGTTCATTCAGCGTGG - Intronic
965061328 3:163788608-163788630 GCTGGGCTGTCAGTTCTGGGTGG - Intergenic
968628008 4:1636831-1636853 GCTGGCCTTTGGGTGGAGGGAGG - Intronic
968908204 4:3464067-3464089 GCTGGGGTGCTGGCTCAGGGCGG - Intronic
979956150 4:126955919-126955941 GCTGGGCTGTCAGTTCAGGGTGG + Intergenic
982222709 4:153138423-153138445 CCTGGCCTGTGGGTTCTGGTTGG + Intergenic
982876922 4:160662167-160662189 GCTGGACTTCTGGTTCAGGTGGG + Intergenic
985647316 5:1091044-1091066 GCAGGCCTGTTGTTTGACGGTGG - Intronic
986743467 5:10724507-10724529 GCTGGCCTATTGCTCCTGGGTGG - Intronic
990006373 5:50948076-50948098 GCTGGCCTCTCGGTGCAGGCTGG + Intergenic
991006447 5:61832703-61832725 AGTGGCCTAGTGGTTCAGGGAGG + Intergenic
992122101 5:73605428-73605450 GCTTGGATGTTGATTCAGGGAGG + Intergenic
992378997 5:76218593-76218615 CAAGGCCTGTTGGTTGAGGGAGG + Intronic
994149792 5:96434022-96434044 GCTGTTGTGTTGATTCAGGGAGG + Intronic
994232101 5:97318401-97318423 GCTGGGCTTTTGGGTCAGGTGGG - Intergenic
996227085 5:121013061-121013083 CCTGGCCTGTGTATTCAGGGAGG - Intergenic
996534106 5:124558329-124558351 GCTGGACTTTTGGGTCAGGTGGG - Intergenic
997335409 5:133105251-133105273 CCTGGCCTGTTTATTCAGGTGGG + Exonic
998423688 5:142009859-142009881 GCTGTCCTGTTGGTTCAAGCAGG + Intronic
1000751118 5:165097679-165097701 CCTGGGCTGTTGCTTCAGAGGGG - Intergenic
1002299120 5:178247660-178247682 GCGGGCTTCTTCGTTCAGGGAGG - Intronic
1002496672 5:179618682-179618704 GCTGGACTGTTGGTGGAGGCTGG - Intronic
1003096246 6:3145416-3145438 GGTGGAGTGCTGGTTCAGGGTGG + Intronic
1003096267 6:3145506-3145528 GGTGGAGTGCTGGTTCAGGGTGG + Intronic
1003096499 6:3146598-3146620 GGTGGAGTGCTGGTTCAGGGTGG + Intronic
1005852550 6:29832623-29832645 GGTGGGCTGTGGGTACAGGGAGG + Intergenic
1006811898 6:36825474-36825496 GGTTGCCTGTGGGGTCAGGGAGG - Intronic
1007484120 6:42168815-42168837 GCTGCCCTCTTGTTTCAGGCTGG - Intronic
1007548800 6:42713380-42713402 CCTGGCCTGGTGGTCCTGGGTGG - Intronic
1008425536 6:51351715-51351737 GCTGGCCTGTTTGTGCAGTGAGG + Intergenic
1010763804 6:79755559-79755581 GAGGGGCTGTTGGGTCAGGGAGG - Intergenic
1011093683 6:83634560-83634582 GCTGCTCTGTTGGTTCAAGTTGG + Intronic
1011645405 6:89452936-89452958 GCTGGACTGATGGTTCAGACTGG + Intronic
1011804804 6:91060133-91060155 TCTGTCTTGTTGGCTCAGGGAGG + Intergenic
1015753891 6:136588832-136588854 GCTGGCCTCTGAGTCCAGGGAGG - Intronic
1016567309 6:145471011-145471033 GCTAGCCTGCTACTTCAGGGAGG - Intergenic
1018428517 6:163704555-163704577 GCTGGCCTGGGGGTTCAAGAAGG + Intergenic
1018685185 6:166298696-166298718 GATGTCCTGTTGGAGCAGGGAGG - Intergenic
1020125092 7:5529179-5529201 GTTGGCCTTGGGGTTCAGGGGGG + Exonic
1022297369 7:29068634-29068656 GCAGTCCTGTGGGTTCAGGACGG - Intronic
1022391888 7:29950532-29950554 GCTGGTCTGCTAGTTCCGGGTGG + Intronic
1022506822 7:30912693-30912715 GCTGGGCATTTGGTTCAGGGTGG - Intronic
1025260183 7:57413367-57413389 GCTGGGCTGGTGGGCCAGGGAGG + Intergenic
1029076018 7:97934939-97934961 GCTGGCATGAAGGTACAGGGAGG - Intergenic
1029797438 7:102910154-102910176 GCTGTCCTGTTGGATCAGAGAGG - Intronic
1030565165 7:111144942-111144964 TCTGAACTGTAGGTTCAGGGAGG + Intronic
1032478562 7:132228502-132228524 GATGGCCGCTTGGTCCAGGGAGG + Intronic
1032919268 7:136527472-136527494 GCTGGGCTGTCAGTTCTGGGTGG - Intergenic
1035366688 7:158352957-158352979 TCTGGCCTATTGGCCCAGGGTGG - Intronic
1036668885 8:10766553-10766575 GCTGGCCTGTTGGTTCAGGGAGG - Intronic
1037486679 8:19354142-19354164 GCTGGCATGGTGGTGCATGGTGG - Intronic
1037712997 8:21370516-21370538 GCTGGGCTGTTGGCTCCTGGAGG - Intergenic
1039413813 8:37376959-37376981 GCTGGCCTCTTGGTGCAAGCTGG + Intergenic
1039736331 8:40336798-40336820 TGTTGGCTGTTGGTTCAGGGGGG - Intergenic
1041699547 8:60773136-60773158 GCAGGCCTGCTGCCTCAGGGGGG + Intronic
1045036730 8:98181797-98181819 GCTGGCGTGGTGTTTCAGGTGGG + Intergenic
1050561058 9:6834777-6834799 GCTGGCCTTGGGGTTCAGGGGGG - Intronic
1058084194 9:100731554-100731576 GTTGGCCTTGTGGTTCATGGGGG - Intergenic
1058336672 9:103838057-103838079 GCTGGCCTGTAAGTTAAGGAGGG + Intergenic
1058900389 9:109437496-109437518 GCTGGCCTTCTTGGTCAGGGTGG + Intronic
1059060132 9:111027210-111027232 CCTGGCCTGTTGATTTGGGGTGG - Intronic
1060700788 9:125747502-125747524 GCTGGCCACTCGGTGCAGGGGGG + Exonic
1061059345 9:128242932-128242954 GCTGGGCTGCAGGGTCAGGGAGG - Intronic
1061394718 9:130337724-130337746 CCTGGCCTGGTGGTTCAGGGAGG + Intronic
1062136704 9:134932947-134932969 CCTGGCCTGTTTGTTCAAGCAGG - Intergenic
1062376893 9:136265922-136265944 ACAGGCCTGGTGGGTCAGGGTGG - Intergenic
1062709706 9:137968179-137968201 CCTCCACTGTTGGTTCAGGGTGG + Intronic
1187253705 X:17622540-17622562 GCTGTCCTGTCACTTCAGGGTGG + Intronic
1187982881 X:24777900-24777922 ACTGGCTTAATGGTTCAGGGTGG + Intronic
1196181641 X:112698422-112698444 GCCATCCTGTTGGTTCCGGGTGG - Intergenic
1197648587 X:129042040-129042062 GCTGGGCTGGTGGTTGAGTGAGG + Intergenic
1200108420 X:153726725-153726747 GCAGGCCTGTGGGCTCAGGCGGG - Intronic