ID: 1036668886

View in Genome Browser
Species Human (GRCh38)
Location 8:10766556-10766578
Sequence CAAGCTGGCCTGTTGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668886_1036668898 5 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data
1036668886_1036668894 -1 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG No data
1036668886_1036668897 2 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668897 8:10766581-10766603 GGCTTCTTTCCCTCAGCTGGGGG No data
1036668886_1036668900 7 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668886_1036668895 0 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG No data
1036668886_1036668896 1 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG No data
1036668886_1036668899 6 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668886 Original CRISPR CAAGCTGGCCTGTTGGTTCA GGG (reversed) Intronic
901239604 1:7685387-7685409 CAAGCTGGTCAGTGTGTTCATGG - Intronic
902197014 1:14805274-14805296 CACGCTGGGGTGTTGCTTCAGGG + Intronic
906533560 1:46538619-46538641 CAGGCTGGCCTATTGGATTATGG + Intergenic
909049665 1:70752920-70752942 CAAGCTGGAGTGATGGCTCAGGG + Intergenic
911545991 1:99217723-99217745 CAAGCTGGGCTCTGGGTTAAGGG - Intergenic
912488852 1:110050123-110050145 CAAGCTGGCCTCTGGCTACAGGG + Intronic
913485058 1:119326603-119326625 CAAGCTGCACTATTGGCTCAGGG + Intergenic
915575070 1:156770287-156770309 CAAGTTGGTCTTTTGGTTCTCGG + Intronic
918066362 1:181104843-181104865 GAAGCAGGCCTCTTTGTTCACGG + Intergenic
918360631 1:183753640-183753662 CAAGCTGGCATTTTGTTTAAGGG + Intronic
918872663 1:189996607-189996629 CAAGTTGGTCTGCTGATTCACGG - Intergenic
924270171 1:242324483-242324505 CAAGCTGCCCTGTTCTTTCCTGG + Intronic
1065204895 10:23347834-23347856 CAAGCTGGCCTCTAGCTTCTGGG - Intergenic
1066479100 10:35778214-35778236 TAAGCTGGGCTGTTTGTTCCTGG + Intergenic
1066714739 10:38274277-38274299 CAAGCTGCCCTGTTCTTTCCTGG - Intergenic
1066783333 10:38976432-38976454 CAAGCTGCCCTGTTCTTTCCTGG + Intergenic
1067710282 10:48644973-48644995 CAAGCTAGCTTTTTGTTTCATGG - Intronic
1070903598 10:80052354-80052376 CAAGCTCCCCTGTTAGTTAAAGG + Intergenic
1074559105 10:114519390-114519412 CAACCTGGCCGGCTGGTTCCCGG - Intronic
1076577697 10:131481188-131481210 CGTGCTGGCCTGTTGATTCAGGG + Intergenic
1078634014 11:13031959-13031981 CAAGATTGCCTTATGGTTCAAGG - Intergenic
1080051358 11:27862331-27862353 CAAGGTTCCCTGATGGTTCAGGG + Intergenic
1080096051 11:28408141-28408163 CACTGGGGCCTGTTGGTTCAGGG + Intergenic
1080909034 11:36576357-36576379 TAAGCTTGCCTGAGGGTTCATGG - Exonic
1081910002 11:46694561-46694583 CATCCTGGCCTGTTTGGTCAAGG - Intronic
1081987046 11:47313064-47313086 CAAGTGAGCCTGTTGTTTCAGGG + Intronic
1091313968 11:134597705-134597727 CAAGAGTGCCTGTTGGTGCAGGG - Intergenic
1093706124 12:22276537-22276559 CAAGGTGGCCAGATGGTTCCAGG + Intronic
1093713444 12:22354230-22354252 CAGGCTGTCATCTTGGTTCATGG + Intronic
1093939348 12:25035947-25035969 GAAGCTGGCCTTTTAGTTCTGGG + Intronic
1100550264 12:95640404-95640426 CTGGCTGGCCTGTTGGTCCCAGG + Intergenic
1104258732 12:127163319-127163341 CATGCAGTCCTGTTGCTTCAGGG + Intergenic
1105054121 12:133081230-133081252 CTAGCTGGCCTGTTCGCTCAGGG + Intronic
1107230363 13:38102456-38102478 CAATGTAGCCTGTTGGTTCCAGG - Intergenic
1107712733 13:43166677-43166699 CATGGTGGCCTGTTGTGTCAGGG - Intergenic
1114343599 14:21771534-21771556 CAAGCTGTCCTGTTCATTCCTGG + Intergenic
1122254846 14:100469108-100469130 GATGCTGGCCTGAGGGTTCAAGG - Intronic
1122872090 14:104643422-104643444 CAAGCTGGCCTGGAGGGTCAGGG + Intergenic
1122961837 14:105097477-105097499 CAAGCTGCCCTCTGGGCTCAGGG + Intergenic
1124242293 15:28038728-28038750 CATGCTGGTCTCTAGGTTCAAGG + Intronic
1125429511 15:39581091-39581113 CGAGCTGGCCTGCGAGTTCAGGG + Exonic
1125437836 15:39667049-39667071 AAAGATGGCCTAGTGGTTCAAGG + Intronic
1129767738 15:78180952-78180974 GAGGCAGGCCTGTTGGGTCAGGG + Intronic
1132278786 15:100594322-100594344 CATGCTGGCCTGTTGATTCTGGG - Intronic
1135628101 16:24013855-24013877 TATGCGGGCCTGCTGGTTCAGGG + Intronic
1138353857 16:56362378-56362400 CAAGATGCCCTGCTGGCTCAGGG + Exonic
1139615910 16:68091773-68091795 AAAGCTGTCCTGGTGGGTCAGGG + Intronic
1142032450 16:87845334-87845356 CTAGCTGCCCTGTGGGCTCAGGG + Intronic
1142534983 17:608304-608326 CAAGCTTCCCTCTTTGTTCAGGG - Intronic
1142614729 17:1127617-1127639 CAGGCTGCCCTGTTGGTGCCTGG + Intronic
1144366956 17:14553923-14553945 AAAGCTGACATGTTGGGTCAAGG - Intergenic
1146442918 17:32912764-32912786 CCAGCGGGCCTGTTGGTGCTGGG + Intergenic
1146666603 17:34709199-34709221 CAAGCTGGCCTCTTTGTTCCTGG + Intergenic
1146917276 17:36686312-36686334 CAAGCCAACATGTTGGTTCAGGG - Intergenic
1147995832 17:44359893-44359915 CAAGCTGCCCTGTGAGTGCAGGG - Exonic
1148190582 17:45676108-45676130 CAGGCTGGATTTTTGGTTCAAGG + Intergenic
1148497403 17:48061159-48061181 CAAGGTGGCCAGATGGTTCCAGG + Exonic
1149181380 17:53941440-53941462 CAAGCTGGCCAGTTGGCACATGG + Intergenic
1150858425 17:68775530-68775552 CAAGCTGTGCTGTTGTTTCCTGG + Intergenic
1151596223 17:75079410-75079432 CAAGCAGGCCTGTGCTTTCAAGG + Intergenic
1151649749 17:75459327-75459349 CATGGTGGTCTGGTGGTTCAAGG - Intronic
1152610864 17:81314473-81314495 CAAGCTAGCCTGTGGGGGCAGGG + Exonic
1155814048 18:30281289-30281311 TAAGCTGGCCTGTGGGTGAAAGG - Intergenic
1156342393 18:36221668-36221690 AACACTGGCCTCTTGGTTCAAGG - Intronic
1156450238 18:37262620-37262642 CACTCTGGCCTATTGGCTCAGGG - Intronic
1156474802 18:37398635-37398657 CAAGGAGGCCTGTTGGTGAAAGG + Intronic
1159967230 18:74607109-74607131 GAAGCAGGCCTCTTGATTCATGG + Intronic
1160209851 18:76868255-76868277 GAAGCTGGCATTTTGTTTCAAGG + Intronic
1168460817 19:56555899-56555921 CCAGCTGGCCTATTCATTCATGG - Exonic
925371876 2:3351588-3351610 GAAGATGGCCTGTGGTTTCAGGG - Intronic
925462207 2:4073419-4073441 CAAGCAGGCCTGTGAGTTCATGG - Intergenic
937111208 2:119368010-119368032 CTAGCTGCCCTGTTGGGGCAGGG + Intronic
940089699 2:149901559-149901581 CAAGCTGAGCCTTTGGTTCATGG - Intergenic
942127331 2:172840350-172840372 TAATCTGTCCTGTTGGGTCAGGG - Intronic
944589831 2:201206720-201206742 CAAGCTGGCATGGTGGTACTTGG - Intronic
946373296 2:219293778-219293800 CAAGCTGGCCTGATGTCTCTAGG - Intronic
1169233834 20:3912613-3912635 CAGGCTGGGCTGTGGCTTCAAGG + Exonic
1171203482 20:23260441-23260463 CAAGCTGGCCTGCTGGTCTTGGG + Intergenic
1171252978 20:23663420-23663442 CCAGCTGGCCTGTAGCTTCATGG + Intergenic
1172286013 20:33740960-33740982 CACTCTGGCCTGTCGGATCAGGG - Exonic
1178561724 21:33643994-33644016 CCAGCTGGCCTGCTGGGTCCTGG - Intronic
1180697024 22:17758062-17758084 CAAGCTGGCCTGTGGCCTCCTGG + Intronic
1181460726 22:23084528-23084550 CAAGAAGGCCTGATGGTTTAAGG - Intronic
1181469139 22:23127304-23127326 CACTCTGGCCTCTTGGTTCCCGG - Intronic
1181469358 22:23128307-23128329 CACTCTGGCCTCTTGGTTCCTGG + Intronic
951597314 3:24332253-24332275 CAAGATTTCCTCTTGGTTCAAGG - Intronic
954791610 3:53137302-53137324 CAAGCTGGGCTGTTGTTTTAAGG - Intergenic
956978720 3:74612997-74613019 TAACCTGGCATCTTGGTTCATGG - Intergenic
961354752 3:126330122-126330144 CCAGCTGGCCTGCTGGCCCAAGG + Intergenic
961722444 3:128905949-128905971 CAAGCTGGCCAGTGTGGTCACGG + Intronic
968032013 3:195508166-195508188 CAAGCTGGAGTTTTGGTACAAGG + Intergenic
968730245 4:2266035-2266057 CAACCAGGCCTCTTGGTGCAGGG - Intergenic
968908205 4:3464070-3464092 CAAGCTGGGGTGCTGGCTCAGGG - Intronic
971288010 4:25308775-25308797 CAGGCTGTCCTGGTGGTTCCAGG + Intergenic
971479538 4:27102044-27102066 AGAGCTGGCCTGCTGGCTCAGGG - Intergenic
974060442 4:57028997-57029019 CAACCTGGACTGTTTGTCCAGGG + Intronic
975725208 4:77285029-77285051 CATCCTGGCCTGTTGCTACAAGG - Intronic
979253223 4:118586722-118586744 CTAGCTGGCCTGCTAGTTCAAGG - Intergenic
981422305 4:144565104-144565126 CAAGCTGTCCTGCATGTTCAAGG - Intergenic
981669747 4:147274319-147274341 CAAGCTGGCCTGAGGATCCAAGG - Intergenic
982215682 4:153080939-153080961 CATGCTGGCCTTCAGGTTCAGGG - Intergenic
982266714 4:153544554-153544576 CAAGCTGGCCTGCTGGCTCCAGG - Intronic
985249282 4:188007256-188007278 CAAGCTGGCATTTGGCTTCATGG + Intergenic
985647317 5:1091047-1091069 CCAGCAGGCCTGTTGTTTGACGG - Intronic
986103180 5:4632508-4632530 CAAGCTGGACTGTTGTCCCATGG + Intergenic
989533219 5:42532204-42532226 CAAGCTGCCCTCATGGCTCAAGG - Intronic
995015803 5:107307329-107307351 CAAGCTGGTCACTTGGCTCAAGG - Intergenic
998122548 5:139590741-139590763 CAAGCTGGGTTGTAAGTTCATGG + Intronic
998169109 5:139861862-139861884 CAAGCTGGGCTGTTCTCTCAGGG - Intronic
998646499 5:144067790-144067812 CAAGAGGCCCTGTTGGGTCAGGG - Intergenic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1001277358 5:170360340-170360362 AAGGCTGTCCTGTTGGTGCATGG - Intronic
1002924091 6:1594923-1594945 CAGGCTGGGCTTTTGGTGCAGGG - Intergenic
1003630224 6:7779948-7779970 AAAGGTGGCCTGTGGTTTCAGGG - Intronic
1004149570 6:13102914-13102936 CAAGCTGGCTTCTTGGACCAAGG - Intronic
1006379538 6:33689472-33689494 CAAGCTGGCCTGCTGCTTCCAGG + Intronic
1008885510 6:56428411-56428433 CAACCTGGCCTAATGGTTCATGG - Intergenic
1012625666 6:101401504-101401526 GAAGCTGGACTGTTGGTTTAGGG - Intronic
1015475862 6:133658303-133658325 CACCATGGCCTTTTGGTTCACGG - Intergenic
1019127277 6:169849211-169849233 CAAGCGGGCCTGTGGGTTTGGGG - Intergenic
1021482054 7:21128952-21128974 CAAGCTGGGCTGAGGTTTCATGG + Intergenic
1022506823 7:30912696-30912718 CAGGCTGGGCATTTGGTTCAGGG - Intronic
1026457539 7:70585722-70585744 CAATCTAGCCAGTTGGTTCAAGG + Intronic
1032468820 7:132163644-132163666 CAAGGTGGCCTAGTGGTGCAAGG - Intronic
1033278256 7:139988664-139988686 CAAGCTGGGCTGATGGTCAAAGG - Intronic
1034757768 7:153639320-153639342 CAGGGTGCCCTGCTGGTTCAGGG + Intergenic
1035164905 7:156981270-156981292 CAAGTTGTTCTGTGGGTTCATGG + Intergenic
1036668886 8:10766556-10766578 CAAGCTGGCCTGTTGGTTCAGGG - Intronic
1037712998 8:21370519-21370541 CCAGCTGGGCTGTTGGCTCCTGG - Intergenic
1037898536 8:22674165-22674187 CAGTCTAGCCTGTTGGTGCAAGG + Intergenic
1037899672 8:22680388-22680410 CAAGCTGCTCTGTTGTTTCCTGG + Intergenic
1041385355 8:57296593-57296615 AAAGTTGTTCTGTTGGTTCAGGG + Intergenic
1042639293 8:70915440-70915462 CAAGCTGCCCTGTTAATTCCTGG - Intergenic
1045166300 8:99609458-99609480 AAAGCGGGCCTGTTACTTCAAGG - Intronic
1045268545 8:100642390-100642412 CAGGCAGCCCTGTTGATTCAAGG - Intronic
1048025877 8:130586209-130586231 GAACCTGGCCTGTTTGTTCTGGG + Intergenic
1048353994 8:133638635-133638657 CAAGCTTCCATGTTTGTTCAGGG + Intergenic
1052377464 9:27733178-27733200 CAAGGTGACCTGTAGGTTCAAGG + Intergenic
1053349591 9:37404337-37404359 CAAGCTGCCCTGTTCATTCCTGG - Intergenic
1055901260 9:81240904-81240926 CAAGAGGCCCTGTTGGGTCAGGG + Intergenic
1056760829 9:89414019-89414041 CCAGATGGCATTTTGGTTCATGG - Intronic
1057484842 9:95474926-95474948 CAAGCTGGCCAGGTTGTTAAAGG - Intronic
1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG + Intergenic
1060361066 9:122958204-122958226 CAAGGTGGCCAGATGGTTCCAGG - Intronic
1061275252 9:129566502-129566524 CAAGCTGGCCTGTTGGGACTGGG - Intergenic
1061432047 9:130537243-130537265 CAGGCTGGGCTGTTGGAACAGGG - Intergenic
1187300482 X:18044404-18044426 CTGGCTAGCCTGTTGGTTAAAGG - Intergenic
1188184908 X:27101813-27101835 CTGGCTAGCCTGTTGGTTTAAGG - Intergenic
1188274371 X:28181817-28181839 CACGCTAGCATGTTGGTTCTAGG - Intergenic
1189275739 X:39784601-39784623 CAAGATTGGCTGTGGGTTCACGG + Intergenic
1194643667 X:96431945-96431967 CAAGCTGTACTGTTGAGTCAAGG - Intergenic
1195196310 X:102500703-102500725 CATTCTGGCCTGCTGGTTTAGGG - Intergenic
1199380455 X:147165974-147165996 CAAGCTTGCCTCTGGGTTTAAGG - Intergenic