ID: 1036668887

View in Genome Browser
Species Human (GRCh38)
Location 8:10766557-10766579
Sequence CCAAGCTGGCCTGTTGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668887_1036668897 1 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668897 8:10766581-10766603 GGCTTCTTTCCCTCAGCTGGGGG No data
1036668887_1036668899 5 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data
1036668887_1036668900 6 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668887_1036668896 0 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG No data
1036668887_1036668898 4 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data
1036668887_1036668894 -2 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG No data
1036668887_1036668895 -1 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668887 Original CRISPR CCAAGCTGGCCTGTTGGTTC AGG (reversed) Intronic
900149908 1:1173819-1173841 CCAAGCTCACCTCTGGGTTCCGG + Intergenic
900185093 1:1329170-1329192 CCAACCCAGCCTCTTGGTTCTGG - Intergenic
900485493 1:2920773-2920795 CCATGCAGGCCTGTTAGTTCAGG - Intergenic
903949078 1:26983819-26983841 ACATGCTGCCCTGTGGGTTCTGG + Intergenic
904369893 1:30041859-30041881 CCAAGGTGGCCTGATGGCTGTGG - Intergenic
907166165 1:52413381-52413403 CCAAGCTGCCCAGTTGTTCCAGG + Intronic
907424861 1:54373174-54373196 CCAACTTCCCCTGTTGGTTCTGG - Intronic
911545992 1:99217724-99217746 CCAAGCTGGGCTCTGGGTTAAGG - Intergenic
913485057 1:119326602-119326624 CCAAGCTGCACTATTGGCTCAGG + Intergenic
917512925 1:175683010-175683032 CCAAGCTCGCCCATTGTTTCTGG - Intronic
919552851 1:199013793-199013815 CCAAGCTGCCCTCTTGTTTCTGG + Intergenic
920051173 1:203165992-203166014 CCCAGCTGGGCTGTTGGCTGGGG + Exonic
924772158 1:247087971-247087993 CCATGATGGCCTCTTGGTTGTGG + Intergenic
1064577818 10:16763655-16763677 CCAAGCTGGGAAGATGGTTCTGG - Intronic
1065204896 10:23347835-23347857 CCAAGCTGGCCTCTAGCTTCTGG - Intergenic
1069621049 10:69837423-69837445 CCAAGCTGGGCACCTGGTTCCGG + Intronic
1073181000 10:101583160-101583182 CCAAGCTGCCCTGGTGATTGTGG + Intronic
1073199326 10:101722152-101722174 CCAGCCTGGCATGGTGGTTCAGG + Intergenic
1076577696 10:131481187-131481209 ACGTGCTGGCCTGTTGATTCAGG + Intergenic
1076931196 10:133533050-133533072 CCAAGCTGGCCTGGGGCTTTGGG + Intronic
1078064022 11:8066208-8066230 CTGAGCAGACCTGTTGGTTCTGG - Intronic
1080051357 11:27862330-27862352 CCAAGGTTCCCTGATGGTTCAGG + Intergenic
1081786561 11:45751660-45751682 CAAAGCTGGCCTGGAGGCTCTGG - Intergenic
1081941961 11:46950819-46950841 CCAGGCTGGTCTGTTGGTCAGGG + Intronic
1083299292 11:61731949-61731971 CCAAGAAGGCCTGTTAGTTAAGG + Intronic
1084733084 11:71087111-71087133 CCAAGGTGGCCGGGTGGCTCTGG + Intronic
1087976652 11:104557510-104557532 CCAAGGTGGCCTGTGACTTCAGG - Intergenic
1093475285 12:19547860-19547882 CCAAACTGTTCTGTTGCTTCAGG - Intronic
1093939347 12:25035946-25035968 TGAAGCTGGCCTTTTAGTTCTGG + Intronic
1096863966 12:54550167-54550189 GCAAGCTGGCCAGTTGGAGCGGG + Intronic
1097175808 12:57142283-57142305 CAAAGCTGGCCTCTTGCTCCGGG - Intronic
1103288868 12:119827188-119827210 CCAAGCCTGCCTGTGGGTTTTGG - Intronic
1104348061 12:128020610-128020632 CTGAGCTTGCCTGTTGGTTTGGG + Intergenic
1104946997 12:132419720-132419742 GAAAGCTGCCCTGTGGGTTCAGG - Intergenic
1105054120 12:133081229-133081251 CCTAGCTGGCCTGTTCGCTCAGG + Intronic
1105752109 13:23430871-23430893 CCAAGGTGACACGTTGGTTCTGG - Intronic
1110191713 13:72737573-72737595 TGAAGCTGGCTTGTTTGTTCTGG - Intronic
1110811042 13:79810669-79810691 CAAAGCTTGCCTATTGGTTTGGG + Intergenic
1113370343 13:109718876-109718898 TAAAGCTTGCCTGTTGATTCAGG + Intergenic
1114187916 14:20417177-20417199 ACAAGCTGTCCGGTTGGTTTTGG + Intergenic
1114413473 14:22521991-22522013 CCAACCTGGCCTGTTTGATCTGG + Intergenic
1115602548 14:34969273-34969295 CCAAGGTGAACTGTGGGTTCCGG + Intergenic
1117481303 14:56148119-56148141 CCAGGCTGACCTCTAGGTTCTGG - Intronic
1117609280 14:57465532-57465554 CCAAGCTGGGCTGTGACTTCTGG + Intergenic
1119434342 14:74587956-74587978 CCGAGCTGGCCTGCTGGCTGTGG + Intronic
1120892113 14:89500555-89500577 CCAAGCTGACCTGTGAGATCAGG + Intronic
1122872089 14:104643421-104643443 ACAAGCTGGCCTGGAGGGTCAGG + Intergenic
1123784580 15:23657429-23657451 ACAAGCAGTCCTGTAGGTTCTGG + Intergenic
1124900108 15:33814553-33814575 CCCAGGTGGCCAGTTGGCTCAGG - Intronic
1125429510 15:39581090-39581112 CCGAGCTGGCCTGCGAGTTCAGG + Exonic
1127998700 15:64171356-64171378 CCCAGCTGGCCTTGGGGTTCAGG - Exonic
1129254852 15:74328464-74328486 CCAAGCTGGCCTGCTGATCTGGG + Intronic
1131886860 15:96925219-96925241 CCAGGTTGGCCTTTTGATTCTGG - Intergenic
1132278787 15:100594323-100594345 CCATGCTGGCCTGTTGATTCTGG - Intronic
1132541230 16:510829-510851 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541258 16:510926-510948 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541271 16:510975-510997 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541300 16:511073-511095 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541315 16:511122-511144 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541330 16:511171-511193 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541398 16:511411-511433 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541426 16:511509-511531 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541441 16:511558-511580 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541456 16:511607-511629 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541524 16:511847-511869 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541539 16:511896-511918 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132541555 16:511945-511967 CCTACCTGGCCTGCAGGTTCTGG - Intronic
1132640726 16:977194-977216 CAAGGCTGGCCTGTTGGCTGGGG - Intronic
1134016217 16:10890260-10890282 CCAAGCTGCCCTGCTGGCTGTGG + Intronic
1135628100 16:24013854-24013876 CTATGCGGGCCTGCTGGTTCAGG + Intronic
1138353856 16:56362377-56362399 CCAAGATGCCCTGCTGGCTCAGG + Exonic
1140890459 16:79280486-79280508 CCAAGCTGGCCTGTGCATACAGG - Intergenic
1141702288 16:85648079-85648101 CCCAGCTGGCCTGTGTGTCCTGG + Intronic
1143482315 17:7234713-7234735 CTAAGCTGGCCTGTGCCTTCAGG + Intergenic
1143646298 17:8232356-8232378 CCAACCTGGCCTGCTGCTTCTGG + Exonic
1144161897 17:12568213-12568235 TCAACCTGGCATGCTGGTTCAGG - Intergenic
1144667952 17:17114839-17114861 CCAGGCTGGCCTGCTGGCTTCGG - Intronic
1144767425 17:17740237-17740259 CCAAGCTGTGCTGGTGGTCCAGG + Intronic
1144961595 17:19047248-19047270 CAAAGCTGTCCTGCTGGCTCAGG + Exonic
1144973565 17:19127276-19127298 CAAAGCTGTCCTGCTGGCTCAGG - Intergenic
1145284532 17:21495521-21495543 CCAGGCATGGCTGTTGGTTCTGG - Intergenic
1146261406 17:31424316-31424338 CCAAGCAAGCCTCCTGGTTCTGG - Intronic
1146442916 17:32912763-32912785 CCCAGCGGGCCTGTTGGTGCTGG + Intergenic
1150656101 17:67040752-67040774 CCTGGCTGGCCTGTATGTTCTGG + Intergenic
1151564329 17:74889136-74889158 CCAAGCTGGGCCATTGGATCTGG - Intronic
1152500891 17:80708408-80708430 CCAAGCTGCCCTGCAGGTGCAGG + Intronic
1152610863 17:81314472-81314494 CCAAGCTAGCCTGTGGGGGCAGG + Exonic
1152824521 17:82456204-82456226 CCAAGCTGTCCAGTTGTTCCTGG + Intergenic
1155343739 18:24838404-24838426 TCAAGGTGGACTGTTGCTTCTGG - Intergenic
1157805581 18:50655302-50655324 CTAAGCTGGGCTTTTGGCTCGGG + Intronic
1160330052 18:77983113-77983135 CCAAGCAGGACAGTTGGTTATGG + Intergenic
1161404550 19:4084241-4084263 CCCACCTGGCCTGTTGCTCCAGG + Intergenic
1161595792 19:5150460-5150482 CGAGGCTGGCCTGGTGGCTCCGG + Intronic
1162058606 19:8081003-8081025 CGAAGCAGGCCTGGTGGTGCTGG + Exonic
1162350003 19:10142812-10142834 CCAAGCTGACCTAATGGTTGGGG - Intronic
1162677280 19:12308626-12308648 CCAAGCTGGCCTCTAGCTCCTGG - Intergenic
1163234936 19:16024656-16024678 CCTGGCTGGACTCTTGGTTCTGG - Intergenic
1164446136 19:28319044-28319066 AAAAACTGCCCTGTTGGTTCAGG + Intergenic
1164840237 19:31387720-31387742 CCAGGCTGGCCTTTTGGATGTGG + Intergenic
925278289 2:2665795-2665817 CCAAGCTGGCCTGGTGCATAGGG - Intergenic
925752178 2:7098376-7098398 CCTCGCTGACCTGTAGGTTCAGG + Intergenic
925973922 2:9127546-9127568 CCAAGGTGGCAAGTTGGTGCTGG - Intergenic
930546631 2:52775488-52775510 CCAGGCTGGGCTCTTGATTCAGG + Intergenic
930945862 2:57074892-57074914 CCAAGATGGCCTCATGGTTTTGG - Intergenic
935062408 2:99620120-99620142 CCAAGCCAGCCTGTTGGTCTGGG - Intronic
939478374 2:142715840-142715862 CCAACATGGCCTGTTGGTCAAGG - Intergenic
940609816 2:155976008-155976030 CCAAGCTGGCTTGTTGCTAATGG + Intergenic
942127332 2:172840351-172840373 CTAATCTGTCCTGTTGGGTCAGG - Intronic
946678679 2:222190042-222190064 CAAAGCTTGCCTGTTGCTTTAGG + Intergenic
947544445 2:231001104-231001126 CCAGGCTGGTCTGTTGGTGGCGG + Intronic
948665999 2:239535351-239535373 TCATGCTGGCCTGTGGGGTCAGG - Intergenic
1171203481 20:23260440-23260462 GCAAGCTGGCCTGCTGGTCTTGG + Intergenic
1177727172 21:24984754-24984776 CCAATCTGCCCTGATGGTTGGGG - Intergenic
1179802394 21:43817080-43817102 CCACGCCTGCCTGCTGGTTCCGG - Intergenic
1180189531 21:46155819-46155841 CCAGGCTGGCCTGATGCTCCTGG - Intergenic
1182551859 22:31104963-31104985 CCACGCTGACCTGTAGGTCCGGG - Exonic
1183524442 22:38315277-38315299 CCAGGCTGGCCTGGTTGTTGGGG - Intronic
1184689038 22:46109136-46109158 CCAGGCTGGAGTGTCGGTTCTGG + Intronic
1184843684 22:47067607-47067629 CCAGGCTGTCCTGTTGTTTCGGG + Intronic
951218466 3:20045495-20045517 CCAAGCAGGCATGGTGGTGCAGG - Intronic
952429198 3:33205677-33205699 CCAGGCTGGCCTGTTGGATGAGG + Intronic
954347157 3:50009772-50009794 CCAGGCTGGCCTTTTGCTCCTGG + Intronic
962324488 3:134422144-134422166 CCTATCTGGCCTGCTGCTTCTGG + Intergenic
964716778 3:159731296-159731318 CAAAGCTGTCCTGTTGATTTGGG - Intronic
968629289 4:1641881-1641903 CCAACCTGGTCCGTTGGGTCTGG - Intronic
968908206 4:3464071-3464093 CCAAGCTGGGGTGCTGGCTCAGG - Intronic
973772392 4:54218853-54218875 CCAAGCTGGTCTGCTGCCTCAGG - Intronic
979956980 4:126966015-126966037 CAAAGCTGGCATTTTGCTTCCGG + Intergenic
980030460 4:127823356-127823378 CCAGGCTGGTCTCTTAGTTCTGG + Intronic
982215683 4:153080940-153080962 CCATGCTGGCCTTCAGGTTCAGG - Intergenic
983342920 4:166488591-166488613 TCATCCAGGCCTGTTGGTTCAGG + Intergenic
985126110 4:186696346-186696368 CCAAGTTAGTCTGTTGGTTGAGG - Intronic
986405532 5:7421093-7421115 CCAAGCTTCCCTGTTCCTTCCGG - Intronic
987218599 5:15765986-15766008 TGAAGCTGGAGTGTTGGTTCAGG - Intronic
990146461 5:52766476-52766498 CCAAGTCGGCCTCTTGTTTCAGG + Intergenic
996556418 5:124783418-124783440 CCAAGCTAGGCTGCTGGTTATGG + Intergenic
999121317 5:149211653-149211675 CAAATCTGGCCAGTTGGTTGTGG + Intronic
999202226 5:149824648-149824670 TCAAGCTGGACAGATGGTTCTGG + Intronic
1001562120 5:172676636-172676658 CCATGCAGGACTGTTGTTTCTGG - Intronic
1003630225 6:7779949-7779971 CAAAGGTGGCCTGTGGTTTCAGG - Intronic
1003893791 6:10587706-10587728 CCAAGCTCCCTCGTTGGTTCAGG + Intronic
1004075348 6:12339739-12339761 CTAAGCTGGCCAGTGGGCTCTGG + Intergenic
1004391214 6:15211244-15211266 ACTAGCTGGGCTGGTGGTTCAGG + Intergenic
1008269068 6:49468188-49468210 CCAGACTGGCCAGTTGGTGCTGG + Intronic
1011457803 6:87570760-87570782 CCAAGCTGGCCTCTAACTTCTGG + Intronic
1012625667 6:101401505-101401527 AGAAGCTGGACTGTTGGTTTAGG - Intronic
1015544505 6:134347756-134347778 CCCAGCTGGCCTCATGGCTCTGG + Intergenic
1019127278 6:169849212-169849234 CCAAGCGGGCCTGTGGGTTTGGG - Intergenic
1023984658 7:45087818-45087840 TGAAGCTGGGCTCTTGGTTCTGG + Intronic
1028150011 7:87361170-87361192 CCAGGCTGGCCTCTAGGTCCTGG + Intronic
1030842184 7:114369039-114369061 CAAGGCTGGCATGTTGTTTCTGG + Intronic
1031020324 7:116620692-116620714 TCAAGCTGGCCTCTGGGTTCTGG - Intergenic
1032736233 7:134695033-134695055 CAAAGCTGGGCAGTTTGTTCTGG + Intergenic
1036668887 8:10766557-10766579 CCAAGCTGGCCTGTTGGTTCAGG - Intronic
1039687806 8:39825106-39825128 CCAAGCTTGCCTGTTGTGTTTGG - Intronic
1041385354 8:57296592-57296614 CAAAGTTGTTCTGTTGGTTCAGG + Intergenic
1042690408 8:71492138-71492160 CCAAGATGGAGTCTTGGTTCAGG + Intronic
1048025876 8:130586208-130586230 AGAACCTGGCCTGTTTGTTCTGG + Intergenic
1054911141 9:70456313-70456335 CCAAGCTGGCCTGGAAGTCCTGG - Intergenic
1054916140 9:70496933-70496955 TCAAGCTGTCCTCTTGCTTCAGG + Intergenic
1056912790 9:90718635-90718657 CCAAGGTGGCATGTGAGTTCTGG - Intergenic
1059723075 9:116980428-116980450 CCAAGCTGGCCACTGGGTTCTGG + Intronic
1060052396 9:120386729-120386751 CCCAGCTGGCCATTTGCTTCAGG - Intergenic
1060780432 9:126408412-126408434 CCACGCAGGCCTGATGGATCCGG + Intronic
1061275253 9:129566503-129566525 ACAAGCTGGCCTGTTGGGACTGG - Intergenic
1061432048 9:130537244-130537266 CCAGGCTGGGCTGTTGGAACAGG - Intergenic
1062054555 9:134464070-134464092 CCTAGGTGGCCAGTTAGTTCTGG + Intergenic
1062121988 9:134838829-134838851 CCAAGCTGGACAGGTGGTTTGGG + Intronic
1062585079 9:137245557-137245579 ACAGGCTGCCCTGTTGGTACAGG - Exonic
1188423771 X:30022795-30022817 CTAAGCTGGCCTGATGCCTCCGG - Intergenic
1192903332 X:75523043-75523065 CCAAGCAGGCCTGCTGGCGCCGG + Exonic
1193312800 X:80026856-80026878 CCAAGTTTACCTGTTGGTTTTGG - Exonic
1197985978 X:132266837-132266859 TAAAGCTGGCCTGTGGGTTCAGG - Intergenic
1200108422 X:153726729-153726751 CCAGGCAGGCCTGTGGGCTCAGG - Intronic