ID: 1036668892

View in Genome Browser
Species Human (GRCh38)
Location 8:10766563-10766585
Sequence AAGCCCCCAAGCTGGCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668892_1036668897 -5 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668897 8:10766581-10766603 GGCTTCTTTCCCTCAGCTGGGGG No data
1036668892_1036668898 -2 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data
1036668892_1036668894 -8 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668894 8:10766578-10766600 GGGGGCTTCTTTCCCTCAGCTGG No data
1036668892_1036668899 -1 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data
1036668892_1036668895 -7 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668895 8:10766579-10766601 GGGGCTTCTTTCCCTCAGCTGGG No data
1036668892_1036668900 0 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668892_1036668896 -6 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668896 8:10766580-10766602 GGGCTTCTTTCCCTCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668892 Original CRISPR AAGCCCCCAAGCTGGCCTGT TGG (reversed) Intronic
900337244 1:2170295-2170317 AAGCCCCCAAACGGTCCTGGAGG - Intronic
901047687 1:6407783-6407805 GAGCCACCATGCTGGCCTGCGGG - Intergenic
903174805 1:21574624-21574646 AAGCAGCCAAGCTGGGCTGGCGG - Intronic
904369898 1:30041865-30041887 AGGCCCCCAAGGTGGCCTGATGG - Intergenic
905653119 1:39669530-39669552 GAGCCCCCAAAATAGCCTGTGGG + Intronic
905971930 1:42148215-42148237 AAGTCACCAAACTGCCCTGTGGG + Intergenic
906480226 1:46194684-46194706 AAGCCCCCAAACTGGTGTCTGGG - Intronic
907240081 1:53076346-53076368 CAGCCCCCAAACTGTCCTGGAGG - Intronic
910263705 1:85316036-85316058 ATGCCTCTAAGCTGGCCTGACGG - Intergenic
912942967 1:114061198-114061220 AAGCTCCCACTCTGGTCTGTGGG - Intergenic
913251709 1:116917336-116917358 GAGTCTCCCAGCTGGCCTGTGGG - Intronic
915338966 1:155166076-155166098 AAGCCCCCCAGCTGGCCTTATGG - Intergenic
920070470 1:203299267-203299289 AAGCACCCAAGCTTGCCTGGCGG + Intergenic
921104031 1:211958668-211958690 AAGAGTCAAAGCTGGCCTGTGGG - Intronic
922776278 1:228215560-228215582 CAGCCCCCAAGCTGGCCGTGAGG + Exonic
1063438388 10:6052887-6052909 ATGCCCCCAAGCTGCTCTGGGGG + Intronic
1064193101 10:13224669-13224691 AAGCCACCAGGCGGTCCTGTTGG - Intronic
1065487569 10:26249712-26249734 GAGCCGCCTAGCTGGCCTGGTGG - Intronic
1066752102 10:38668568-38668590 GAGACTCAAAGCTGGCCTGTAGG - Intergenic
1066964931 10:42254485-42254507 GAGACTCAAAGCTGGCCTGTCGG + Intergenic
1067046892 10:42990095-42990117 AGGCCCTCAAGGTGGCCTGGAGG - Intergenic
1070961863 10:80505189-80505211 ATGCCCCCAGGGTGCCCTGTGGG + Intronic
1072726230 10:97815782-97815804 AAGGTCCCAATCTGGCCTGTGGG - Intergenic
1075585878 10:123657779-123657801 AAGGCCCAGAGCTGGCCTCTGGG - Intergenic
1075778974 10:125004945-125004967 TAGTCCCCAAGCTGGCCACTTGG + Intronic
1076243489 10:128928069-128928091 GTGCCCCCCAGCTGGCCTGGGGG - Intergenic
1077543820 11:3160204-3160226 GAGCCCCGACGCTGGCCCGTGGG - Intronic
1078903518 11:15663399-15663421 AAGCTCCCATACTGGCCAGTGGG - Intergenic
1080004184 11:27387684-27387706 AAACCCCCTACCTGGCCTATAGG - Intronic
1080554008 11:33399488-33399510 AAGTCCCCAAGCTTTCCTGGTGG + Intergenic
1081268582 11:41057528-41057550 AAGTTCCCAATCTGGTCTGTGGG - Intronic
1081348209 11:42016421-42016443 AAGCACCTAAGCTTGCCTGGAGG - Intergenic
1083171416 11:60925647-60925669 CAGCCCCACAGCTGGACTGTGGG - Intronic
1086402858 11:86474561-86474583 AAGCCCCCAAGCCAGCCAGTGGG - Intronic
1092783591 12:12008770-12008792 AAACCCCAAAGCTGAGCTGTGGG + Intergenic
1096691953 12:53326821-53326843 AGGCCCCCAAGCTGATCTGGTGG - Exonic
1099791348 12:87338571-87338593 AAACCCCTAAGCTTGCCTTTAGG - Intergenic
1102490721 12:113288242-113288264 CAGCCCCCACCCTGGCCTGCAGG + Intronic
1102543986 12:113641575-113641597 AAGCCCCCAGCCAGGCCTGCTGG + Intergenic
1102965250 12:117120620-117120642 AAGTCCCCAAGGTGACCTGGAGG - Intergenic
1103166305 12:118773341-118773363 AAGCCCCCAAAGTTGCCTTTTGG - Intergenic
1104786631 12:131454659-131454681 AAGTCCACAAGCTGGCAGGTGGG + Intergenic
1108180645 13:47836810-47836832 TGGCCCCCAAATTGGCCTGTGGG + Intergenic
1111784353 13:92768680-92768702 AATTCCCGAAGCTGGCCAGTGGG + Intronic
1113291967 13:108917217-108917239 GAGCCACCAAGATGGCCTTTTGG - Intronic
1117736422 14:58773288-58773310 AACCCCTCCAGGTGGCCTGTGGG - Intergenic
1120724194 14:87919449-87919471 AATCCCCAAAGCAGGCCTGTGGG - Intronic
1121224144 14:92308919-92308941 GAGCCCCCATGCTGGCCTCGCGG + Intergenic
1124277237 15:28336274-28336296 AGGCCCCCCACCTGCCCTGTTGG - Intergenic
1124305464 15:28575332-28575354 AGGCCCCCCACCTGCCCTGTTGG + Intergenic
1126749308 15:51860552-51860574 AATCCACAAAGCTGGCTTGTTGG + Intronic
1129544188 15:76377085-76377107 AAGCACCACTGCTGGCCTGTGGG + Intronic
1129697674 15:77749832-77749854 CAGCCCTCAAGCTGGCCCTTGGG - Intronic
1130983098 15:88826432-88826454 GAGCCACCATGCTGGGCTGTAGG + Intronic
1132339379 15:101068486-101068508 AAGCCCACAGGCTGGCCACTGGG + Intronic
1133384043 16:5354488-5354510 TAACCCCCAAGCAGCCCTGTTGG - Intergenic
1134807385 16:17137538-17137560 AAGCCACCATGCTGGCTTGGAGG + Intronic
1135220435 16:20610541-20610563 AAGCCTCTAAGCTAGCCTCTCGG - Intronic
1135220749 16:20612321-20612343 AAGCCTCCCAGCTGGACTGTCGG - Intronic
1136730621 16:32408473-32408495 GAGACTCAAAGCTGGCCTGTCGG + Intergenic
1140790792 16:78389082-78389104 CAGACCCCAAGCTGGCTTGTAGG + Intronic
1141957336 16:87381738-87381760 GAGCCCCCACGCTGGCTGGTAGG - Intronic
1142192207 16:88723210-88723232 ACGCCCCCCAGCTCACCTGTGGG + Exonic
1202995777 16_KI270728v1_random:108842-108864 GAGACTCAAAGCTGGCCTGTCGG - Intergenic
1203022464 16_KI270728v1_random:421184-421206 GAGACTCAAAGCTGGCCTGTCGG - Intergenic
1143539855 17:7562342-7562364 AAGCCCCTATGCGGGCCTCTGGG - Intronic
1144379108 17:14675402-14675424 CAGCCCCCAAAATGCCCTGTTGG - Intergenic
1145272209 17:21410749-21410771 AAGCTTCCAGGCTGGGCTGTAGG - Intronic
1145310417 17:21698214-21698236 AAGCTTCCAGGCTGGGCTGTAGG - Intronic
1147746959 17:42700684-42700706 ATACCCTCAAGCTGGACTGTGGG - Exonic
1147772826 17:42879473-42879495 AAGCCCCCAAGGTGGCCTGTTGG + Intergenic
1148552581 17:48559401-48559423 TAGCTCCCAAGCTAGCCTTTGGG - Intronic
1148804413 17:50257156-50257178 AAGCCAGCAAGCTTGCTTGTTGG + Intergenic
1149005138 17:51797454-51797476 ATGCCCCCAAGATGGTCAGTAGG - Intronic
1149339424 17:55670526-55670548 AATCCCCAAAGCTGGCTTATGGG + Intergenic
1150478583 17:65492191-65492213 AAGACCCCTTGCTGTCCTGTGGG - Intergenic
1152091481 17:78249986-78250008 AAGCCTCCATGCTGGGCTCTGGG + Intergenic
1153297891 18:3565113-3565135 AAGGCACCAAGCTGGGCTGGTGG + Intronic
1154069607 18:11141452-11141474 AAGCCTCCAACCTGGCCTCTTGG - Intronic
1159227159 18:65554522-65554544 AATCCCTCAAACTGGCCCGTGGG + Intergenic
1159668830 18:71197746-71197768 AAGCCACCACCCTGGCCAGTGGG + Intergenic
1163536051 19:17877138-17877160 TAGCCCCCAATCTGGTCTGAGGG - Intronic
1168354227 19:55691923-55691945 CAGCCCCCACGCCGGCCTCTGGG + Exonic
1168671271 19:58243110-58243132 GAGCCACCATGCTGGCCTTTGGG + Intronic
924961384 2:37727-37749 AAGCCCCCAAGTTTACCTGAAGG + Intergenic
925028527 2:628850-628872 AAGTCCCCAGGCAGGCTTGTTGG + Intergenic
925147749 2:1592242-1592264 AAGCCCGCAGGCTGCCCTGCTGG + Intergenic
925370596 2:3342514-3342536 TGGCCCCCAAGCTGGCCCCTCGG + Intronic
925848247 2:8053029-8053051 AAGCCTTCAAGCTGGCTTCTGGG - Intergenic
926008347 2:9389864-9389886 AAACCCCCAGGCTGGCTGGTCGG + Intronic
926625440 2:15086074-15086096 AAGTCCCCACTCTGGTCTGTGGG - Intergenic
926679533 2:15653204-15653226 AAGCCTCCCTGCTGCCCTGTGGG + Intergenic
928363982 2:30687688-30687710 AAGGCCTCAAGCTTGACTGTAGG - Intergenic
929737577 2:44566550-44566572 AAGCCCCCACGGTGGCCTTATGG - Intronic
932218090 2:69979585-69979607 AGGCCCCCAAAATGGCCTGGGGG + Intergenic
932231190 2:70086123-70086145 AAGCCCACAGGCTGGTCTGAAGG - Intergenic
932285141 2:70525375-70525397 CAGCCCCCAAGGTGGACAGTGGG - Intronic
932804411 2:74770635-74770657 AAGCTCCCAAGTTAGGCTGTAGG - Intergenic
937317712 2:120942464-120942486 AAGACCCCATGATGGCATGTAGG + Intronic
937414735 2:121705353-121705375 AAGTTCCCAAGCTGTCCTGATGG - Intergenic
944483824 2:200182520-200182542 AAGTCCCCACTCTGGTCTGTGGG - Intergenic
946781529 2:223196610-223196632 AGGACCCAAAGCTGGCCTCTAGG + Intronic
947544439 2:231001098-231001120 CTGCCCCCAGGCTGGTCTGTTGG + Intronic
948232170 2:236356477-236356499 TGGCCCCCCAGCTGGCCTCTGGG - Intronic
948232274 2:236358843-236358865 TGGCCCCCCAGCTGGCCTCTGGG + Intronic
948403636 2:237701969-237701991 TATCTCCCCAGCTGGCCTGTGGG + Intronic
948929420 2:241122596-241122618 AAGCACACAACCTGGCATGTGGG - Intronic
948942870 2:241204748-241204770 CAGCCCCCAAGCTGGGCTGAGGG + Intronic
1173809300 20:45946581-45946603 ACACCCCTAAGCTGGCCTGTGGG + Intronic
1173873605 20:46356655-46356677 GACCTCCCAAGCTGTCCTGTGGG - Intronic
1173884560 20:46445927-46445949 AAGCTCCCACTCTGGTCTGTGGG + Intergenic
1174170296 20:48613605-48613627 CAGCCCCCAGCCTGGTCTGTAGG - Intergenic
1174973438 20:55304444-55304466 AGGCCTCCAATCTGGCTTGTAGG + Intergenic
1175365212 20:58449109-58449131 AGCCTCCCAAGCTTGCCTGTCGG - Exonic
1175924389 20:62464880-62464902 AAGCCCCCAGGCTGGCCTCAGGG - Exonic
1176236590 20:64056435-64056457 GAGCCCCCAAGGTGGGCTGGAGG + Intronic
1178244389 21:30936694-30936716 AAGTCCCCACTCTGGTCTGTGGG - Intergenic
1178618451 21:34153793-34153815 AAGCCCCCAAGCAGGTCCGAGGG - Intergenic
1180089903 21:45528547-45528569 AAGCCCGCATGCCGGCCTGCAGG + Intronic
1180541854 22:16456593-16456615 GAGACTCAAAGCTGGCCTGTCGG - Intergenic
1181051349 22:20239606-20239628 CAGCCCCGAAGCTGGCCTGAGGG + Intergenic
1181277171 22:21694481-21694503 GAGCCCCGAGGCTGGCCTGGTGG - Intronic
1181983052 22:26779885-26779907 GAGAGCTCAAGCTGGCCTGTTGG + Intergenic
1182163351 22:28146143-28146165 AAGCCCCTAACTTGGCTTGTAGG + Intronic
1182241320 22:28918631-28918653 CAGCCACCAAGCTTGCCTGGTGG + Intronic
1182702605 22:32252741-32252763 AAGACCCCAAGCTGGCTAGGAGG + Intronic
1183300811 22:37058246-37058268 GAGCCCCCAGGATGGCCTGGAGG + Intronic
1184613576 22:45622349-45622371 AAGTCCCCATTCTGGTCTGTGGG - Intergenic
1184767732 22:46580325-46580347 GAGACCCCAAGCCAGCCTGTGGG - Intronic
1184857002 22:47151790-47151812 AAGCCACCATGCCGGCCTGTCGG + Intronic
1184889204 22:47369217-47369239 GAGTCCCCAACCTGGGCTGTGGG + Intergenic
949315952 3:2755670-2755692 CAGTCCCCAAACTGGACTGTGGG - Intronic
953545056 3:43858199-43858221 TAGTCCCCAAGCTGTCCTGCTGG - Intergenic
954393240 3:50278552-50278574 CAGCACCCATGCTGGCCAGTGGG - Intergenic
961013663 3:123450929-123450951 TTGCCCCCAAGCTGTCCTGCTGG + Intergenic
965216208 3:165868140-165868162 CACCCCCCTACCTGGCCTGTGGG + Intergenic
968623270 4:1614199-1614221 AAGCCCCACAGCCGGCCTCTGGG - Intergenic
969259079 4:6022341-6022363 AAACCTCCCAGCTGACCTGTGGG + Intergenic
974136310 4:57822911-57822933 ACGCCCCCCAGCTAGCCTGCTGG + Intergenic
975122778 4:70747196-70747218 AAGCTCTAAAGCTGGTCTGTGGG - Intronic
986591638 5:9376473-9376495 AAGCCCACATCCTGGGCTGTAGG - Intronic
986960643 5:13206630-13206652 AATCGCCCAAACTGGCCTCTAGG - Intergenic
997411883 5:133696928-133696950 TGGACCCCAAGCTTGCCTGTAGG + Intergenic
997528549 5:134568640-134568662 CAGCCACCAAGCTGGGCTGGCGG + Intronic
997570074 5:134920639-134920661 AAGCCTCCATCCTGCCCTGTTGG - Intronic
997627175 5:135339044-135339066 CAGCCCCTGACCTGGCCTGTGGG + Intronic
997747782 5:136314706-136314728 AAGCCCCCAGACTGGCCTCTGGG - Intronic
1001492853 5:172168036-172168058 AAGGCTCCCAGCTGACCTGTCGG + Intronic
1002023821 5:176383507-176383529 AGGCCCCCAACCTGGCTTCTGGG - Intronic
1003454807 6:6271895-6271917 AATCCCCCCAGCTGGGATGTAGG + Intronic
1006221128 6:32492840-32492862 AAGCCCCCAAGGTGTCCTCAAGG - Intergenic
1007841882 6:44723179-44723201 AATCCCTGAAGCTGGCTTGTGGG + Intergenic
1016374161 6:143403463-143403485 GAGCCTCCATCCTGGCCTGTTGG + Intergenic
1017727253 6:157284186-157284208 AAGCCCCCAAGCTGGATTGCTGG - Intergenic
1021786015 7:24153334-24153356 GAGCCCTCAAGATGGACTGTTGG - Intergenic
1023338874 7:39197888-39197910 AAGGCCTGGAGCTGGCCTGTGGG + Intronic
1023710988 7:42992338-42992360 AAGCCCACAAGGAGGCCTGCTGG - Intergenic
1026539682 7:71269013-71269035 AAGCTCTCCAGCTGGCCTCTAGG - Intronic
1026765535 7:73157223-73157245 AAGCCCCCCTGCTGGCCTCTGGG + Intergenic
1027042008 7:74966916-74966938 AAGCCCCCCTGCTGGCCTCTGGG + Intronic
1027081633 7:75235438-75235460 AAGCCCCCCTGCTGGCCTCTGGG - Intergenic
1029390218 7:100270019-100270041 AAGCCCCCCTGCTGGCCTCTGGG - Intronic
1032162665 7:129522752-129522774 GAGCCACCAGGCTGGCCTGAAGG - Intergenic
1034255784 7:149723983-149724005 AGGCCCCCATATTGGCCTGTCGG + Intronic
1035434556 7:158849892-158849914 GAGCCCCCACTCTGGTCTGTAGG + Intergenic
1036668892 8:10766563-10766585 AAGCCCCCAAGCTGGCCTGTTGG - Intronic
1036760839 8:11507635-11507657 AAACCCCCAAGCTGGTCCATTGG - Intronic
1038059146 8:23892866-23892888 AAGGCCCCCAGCTGACCTCTGGG + Intergenic
1038375423 8:27035602-27035624 AACCCCCAAAGCGGGGCTGTTGG + Intergenic
1038658490 8:29475804-29475826 ATCCCACAAAGCTGGCCTGTGGG - Intergenic
1040323010 8:46327975-46327997 AAGCACCCAAGGTGCCCCGTGGG - Intergenic
1040323290 8:46329081-46329103 ATGCCCCCAGGGAGGCCTGTCGG - Intergenic
1042137460 8:65645371-65645393 AAACCCCAAAGCCGGCCTTTGGG + Intronic
1044475728 8:92623948-92623970 AATCCCCAAAGCTGCCTTGTTGG + Intergenic
1046088482 8:109468691-109468713 AAGCCCCCATTCTGGCTGGTGGG + Intronic
1046913411 8:119653657-119653679 AAGCCTCCATTATGGCCTGTAGG - Intronic
1047507528 8:125491654-125491676 TAGCCCCAAATCTGGCCTGAGGG - Intergenic
1047742279 8:127816149-127816171 ATGCCTCCCAACTGGCCTGTAGG - Intergenic
1048017810 8:130513145-130513167 AAATCCCCAAGCTGACCTGTGGG - Intergenic
1053614255 9:39746914-39746936 AAGCGCAGAAGCTGGGCTGTGGG - Intergenic
1053872284 9:42504855-42504877 AAGCGCAGAAGCTGGGCTGTGGG - Intergenic
1053900471 9:42791079-42791101 AAGCGCAGAAGCTGGGCTGTGGG + Intergenic
1054239261 9:62595478-62595500 AAGCGCAGAAGCTGGGCTGTGGG + Intergenic
1054261173 9:62866538-62866560 AAGCGCAGAAGCTGGGCTGTGGG - Intergenic
1054553392 9:66630000-66630022 AAGCGCAGAAGCTGGGCTGTGGG + Intergenic
1054929265 9:70619122-70619144 AAGTCTCCAAGCTGACCTGAAGG - Intronic
1056192044 9:84194448-84194470 AAGTCCCCACTCTGGTCTGTGGG + Intergenic
1057278913 9:93696809-93696831 AAGCTCCCAAGCAGGGATGTTGG - Intergenic
1058417144 9:104801094-104801116 AAGCTGGCAAGCTGGTCTGTAGG - Intronic
1061400459 9:130365511-130365533 GAGCCCCCAAGCTGCCCACTTGG - Intronic
1061927493 9:133813106-133813128 GAGCCCCCAACGGGGCCTGTGGG - Intronic
1062184716 9:135211770-135211792 AAGTTCCCACGCTAGCCTGTGGG - Intergenic
1062210421 9:135360590-135360612 AAGCCCCCGACCTGGCCTCCTGG + Intergenic
1062217920 9:135399189-135399211 GAGCCCCTACGCTGGCCTGGGGG - Intergenic
1196040239 X:111194901-111194923 CAGCCCCCAAGTGGGCCTGACGG + Intronic
1201182765 Y:11365519-11365541 GAGACTCAAAGCTGGCCTGTCGG - Intergenic