ID: 1036668893

View in Genome Browser
Species Human (GRCh38)
Location 8:10766571-10766593
Sequence AGGGAAAGAAGCCCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668893_1036668898 -10 Left 1036668893 8:10766571-10766593 CCAGCTTGGGGGCTTCTTTCCCT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1036668898 8:10766584-10766606 TTCTTTCCCTCAGCTGGGGGTGG No data
1036668893_1036668899 -9 Left 1036668893 8:10766571-10766593 CCAGCTTGGGGGCTTCTTTCCCT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1036668899 8:10766585-10766607 TCTTTCCCTCAGCTGGGGGTGGG No data
1036668893_1036668900 -8 Left 1036668893 8:10766571-10766593 CCAGCTTGGGGGCTTCTTTCCCT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668893 Original CRISPR AGGGAAAGAAGCCCCCAAGC TGG (reversed) Intronic
900927895 1:5717581-5717603 AGGGAAAGAAGGCTCAAAGCGGG - Intergenic
901084220 1:6601040-6601062 AAGGAAAGAACCCACCAGGCAGG - Intronic
903050468 1:20596725-20596747 AGGGAAAGAAGCTCACAATGAGG - Intronic
903935290 1:26890987-26891009 ATGAAAGGAAGCCCCCAACCCGG + Exonic
904812170 1:33170583-33170605 GGGGAGAGAAGGCCCCCAGCAGG + Intronic
904829344 1:33296643-33296665 GGGGAAAGAAGCTTCCATGCAGG + Intronic
904875972 1:33654819-33654841 AAGGGAAGAAGCCCCTGAGCTGG - Intronic
905388060 1:37617934-37617956 AGGGAAACAAGCCACAAAGGAGG + Intronic
905929317 1:41776138-41776160 AAGGAAAGAGGCTGCCAAGCAGG + Intronic
906293407 1:44634534-44634556 AGGGAAAGGTTCCCCAAAGCAGG - Intronic
906480228 1:46194692-46194714 ATGGGAAAAAGCCCCCAAACTGG - Intronic
907993740 1:59608409-59608431 TGGTAAAGAACTCCCCAAGCAGG - Intronic
908943054 1:69459715-69459737 ATGGAAAAAACCCTCCAAGCGGG - Intergenic
914223151 1:145698390-145698412 AGAGAATGGAGCCCCCGAGCTGG + Intronic
915338967 1:155166084-155166106 AGAGAGAGAAGCCCCCCAGCTGG - Intergenic
917507982 1:175646481-175646503 AGGGTAAGAAGCCTACAAGAGGG - Intronic
917519094 1:175733464-175733486 AGGGATGAAAGCCCCCAAGAGGG - Intronic
917599237 1:176558398-176558420 AGGGAAAGAAGTCGGCAAGGAGG + Intronic
917865393 1:179189785-179189807 AGAGACAGAAGCGCACAAGCTGG + Intronic
918120650 1:181536848-181536870 AGGAAAATATGCCCACAAGCAGG - Intronic
918726100 1:187926057-187926079 AGGGAAAGAGGACACGAAGCTGG - Intergenic
919512366 1:198481123-198481145 AAGGAAAGAAGCCTCCAAAGAGG - Intergenic
920067472 1:203278977-203278999 AGGCCAGGAAGCCCCCAAGAAGG - Intergenic
922279923 1:224114111-224114133 AAGGAATCAAGCCCCCAAGATGG + Exonic
924582757 1:245335932-245335954 AGGGAAAGAGGGTCCCACGCAGG + Intronic
924582817 1:245336152-245336174 AGGGAAAGAAGGTCCCACGCAGG + Intronic
1062989072 10:1798844-1798866 TGGGAAAGCTGCCCTCAAGCTGG - Intergenic
1063310683 10:4949234-4949256 AGAGAAAGGAACCCCCAAGGTGG + Intronic
1063494582 10:6495143-6495165 ATGGAAGGAATCCTCCAAGCGGG - Intronic
1064637115 10:17379641-17379663 AAGGCAGGAAGCCTCCAAGCAGG - Intronic
1065342576 10:24721979-24722001 AGGGGAAGAATTCCACAAGCAGG + Exonic
1067774478 10:49153033-49153055 GGGGAAAGGAGCCTCCAAGCTGG + Intergenic
1067893393 10:50154115-50154137 GGGGAAAGAAGCGGGCAAGCGGG + Intergenic
1069106789 10:64393175-64393197 AGAGAAAGAAGCCCCTGAGCAGG + Intergenic
1071603936 10:86971886-86971908 AGGGGACGAAGTCCCCAACCTGG + Intronic
1073512917 10:104053557-104053579 AGGGCAAGAAGGAGCCAAGCAGG - Intronic
1077543822 11:3160212-3160234 AGGGAGAGGAGCCCCGACGCTGG - Intronic
1078552502 11:12290242-12290264 AGAGAAAGAGACCCCCTAGCAGG + Intronic
1078610478 11:12815057-12815079 AGGGAAAGACGCAGGCAAGCTGG + Intronic
1084955732 11:72690417-72690439 TGAGAATGAATCCCCCAAGCTGG + Intronic
1086755576 11:90558017-90558039 AGTGACACAAGCCACCAAGCTGG - Intergenic
1087960051 11:104337524-104337546 AGGCAGAGAAGCCACCAAGGAGG - Intergenic
1088916539 11:114232119-114232141 AGGAAAAGAAGCCCCAAAGCGGG - Intronic
1091356583 11:134942203-134942225 TGGGAAACACACCCCCAAGCTGG - Intergenic
1091643091 12:2252501-2252523 AGGCTAAGAAGCCCCGGAGCAGG + Intronic
1092166531 12:6346143-6346165 AGGGACAGAATCCCCAAAGATGG + Intergenic
1093540563 12:20278676-20278698 AAGCAAGGAAACCCCCAAGCAGG - Intergenic
1096514798 12:52149837-52149859 AGGGAAGGAAGGCCCACAGCAGG - Intergenic
1096977227 12:55706514-55706536 AGAGAGAAAAGCCCCCTAGCAGG + Intronic
1096978698 12:55716285-55716307 AGGGAAAGACGCCAGCTAGCGGG + Intronic
1097160920 12:57046261-57046283 AGGGAAAGCAGAACCCAGGCAGG + Intronic
1097381258 12:58898446-58898468 GGTGAAAGAAACCCCCAAGAGGG - Intronic
1101530247 12:105567052-105567074 AGATAGTGAAGCCCCCAAGCAGG - Intergenic
1102487115 12:113266082-113266104 AGGAAAGGAAGGCCCCAGGCAGG - Intronic
1102506729 12:113388715-113388737 AGAGAACGAAGCCCCCAGGAGGG - Exonic
1102573789 12:113843514-113843536 AGGCAGAGAAGCTCCCCAGCTGG + Intronic
1102867167 12:116383493-116383515 GGAGAAAAAAGCCTCCAAGCAGG + Intergenic
1103468043 12:121157555-121157577 AGGGAAACAGGCCCCCAAACTGG - Intronic
1103741683 12:123095650-123095672 AGGGCACGAGGCCCCCAACCTGG + Intronic
1104149938 12:126072566-126072588 AAGGAAAGAAAGCCCCATGCAGG - Intergenic
1104437073 12:128765046-128765068 AAAGAAAGAAACCCCCAACCAGG + Intergenic
1106603975 13:31210458-31210480 AGGGAAAGATCCCTCCAACCTGG - Intronic
1107327067 13:39255843-39255865 ACAAAAAGAAGGCCCCAAGCAGG - Intergenic
1107975458 13:45683949-45683971 AGGGGAAGGACCCCCCAGGCAGG - Intergenic
1111993383 13:95138888-95138910 AGGGAAAGGAGCTGCCCAGCTGG - Intronic
1113347341 13:109492921-109492943 AGGAACAGAAGGCCCCAGGCTGG + Intergenic
1114317975 14:21524911-21524933 AGGGGCAGAAACGCCCAAGCAGG - Exonic
1115930214 14:38482730-38482752 AGAGAAAGAACCCCCCTGGCAGG + Intergenic
1116865889 14:50031309-50031331 AGGGAAGGAAGACACGAAGCAGG - Intergenic
1117951889 14:61091053-61091075 AGGCACAGACGCCCACAAGCAGG + Intergenic
1119790863 14:77348624-77348646 AGGAAATGATGCCCTCAAGCAGG - Intronic
1121330557 14:93046951-93046973 AGGGAAGGGAGACCCAAAGCAGG - Intronic
1123130296 14:105980283-105980305 AGGGGATGAAGCCCGCATGCTGG - Intergenic
1124385911 15:29207981-29208003 AGGGACACAAACCCCCACGCTGG + Intronic
1126097913 15:45102207-45102229 AGAGAAAGCAGCCCTCAAACAGG + Intronic
1128113850 15:65093434-65093456 AAGGAAAGAAGGCCCCAGCCTGG + Intronic
1128668401 15:69555513-69555535 AAGGAAAGAAGTGTCCAAGCTGG + Intergenic
1129616050 15:77099336-77099358 AGGAAAAGAAGCCCCCTTGCAGG + Intergenic
1129701579 15:77771568-77771590 TGGGAAAGAAGCCTCCAACCTGG + Intronic
1132435922 15:101802734-101802756 AGGGAAAGAGGCCTCCAATGTGG - Intergenic
1132670136 16:1099114-1099136 AGGGAGTGAAGCCCCCACCCAGG + Intergenic
1135898743 16:26435099-26435121 TGGGAAAGAAGCCCTCAACAGGG - Intergenic
1136703728 16:32168065-32168087 AAGGGGAGAAGCCCCGAAGCAGG + Intergenic
1136763980 16:32759537-32759559 AAGGGGAGAAGCCCCGAAGCAGG - Intergenic
1136804119 16:33110849-33110871 AAGGGGAGAAGCCCCGAAGCAGG + Intergenic
1137270957 16:46901933-46901955 GGGGAAAGGAGCCCGGAAGCCGG - Intronic
1139945481 16:70638539-70638561 AGGATAAGAAGCCACCAACCAGG - Intronic
1140818403 16:78641257-78641279 AGGCAGAGAAGCCCCCAGACCGG + Intronic
1142221194 16:88856106-88856128 AGGGAAGGAGGCCTCCAGGCTGG + Intronic
1142396260 16:89833480-89833502 AGGGAAAGCAGCCACCCAGGTGG + Intronic
1203066328 16_KI270728v1_random:1021663-1021685 AAGGGGAGAAGCCCCGAAGCAGG - Intergenic
1143374972 17:6462000-6462022 AGGGAAAGAGGCCGCCCAGGAGG - Intronic
1143456697 17:7072446-7072468 TGGGAGAGAAGCCACCCAGCAGG - Intergenic
1143556705 17:7666486-7666508 AGGGAAAGAAGTCACCAAGTAGG + Intronic
1145103600 17:20096896-20096918 AGGGAAGGAGGCTCCCAAGGAGG + Intronic
1146163075 17:30570338-30570360 AGGAAGAGAGGCCCCCAGGCAGG - Intergenic
1147952736 17:44116046-44116068 AGGGAAAGAAACCCCAAAGCTGG + Intronic
1148137805 17:45306479-45306501 AGGGAAGAAAGACTCCAAGCTGG + Intronic
1148357343 17:46984352-46984374 GGGGAAAGACTCCCCCGAGCCGG + Intronic
1150252571 17:63715653-63715675 GGGGAAAGAAACCCTCAAGTGGG + Intronic
1152409099 17:80112973-80112995 AGGGGTAGAAGGCCCCCAGCTGG - Intergenic
1152944239 17:83190537-83190559 AGGGAAACAGGCCTCCAAGCTGG - Intergenic
1157091600 18:44643328-44643350 AGGGAAAGAACCTGCCATGCTGG - Intergenic
1157483622 18:48072268-48072290 GGGGTAAGAAGACCCCAAACGGG + Intronic
1158116726 18:54004544-54004566 AAGGAAAGAAGCCCTAAAGAAGG + Intergenic
1158509843 18:58080632-58080654 AGGGACAGATGCCCTCAGGCGGG + Intronic
1158647876 18:59264008-59264030 AGGGCAAGAAGGCACCAAGGGGG + Intergenic
1160705639 19:528957-528979 AGAGTAGGGAGCCCCCAAGCAGG + Intergenic
1160968241 19:1755910-1755932 AGGGAAAGAAACCCCCACCTAGG - Intronic
1164580042 19:29429342-29429364 AGGGAAAGAAGCCGATAAGCAGG - Intergenic
1165689517 19:37852547-37852569 AGGGGAAGAAGCCACTAAGAAGG + Intergenic
1165823909 19:38694559-38694581 AGGTCAAGAAGCCCCCAGCCAGG - Intronic
1165975753 19:39675158-39675180 TAGGAAAGAAGCCACAAAGCAGG - Intergenic
1167503984 19:49861922-49861944 GGGGAGAGAAGACCCCGAGCGGG + Intronic
926122781 2:10253967-10253989 GGGGCAAGAGGCCCTCAAGCCGG + Intergenic
926586133 2:14687593-14687615 GGGGAAAGAAAAGCCCAAGCAGG - Intergenic
931714697 2:65019833-65019855 AGGGAAACAGGGCACCAAGCCGG + Intronic
932421129 2:71602077-71602099 AGGGAATGAAGCCCCCGTCCAGG - Intronic
932891914 2:75604878-75604900 AGGAGAAGAAAGCCCCAAGCGGG - Intergenic
932902750 2:75717857-75717879 AGTGAAATAAGCCACCAAGAAGG - Intergenic
937994329 2:127681344-127681366 AGGGAAGGAAGCACCCGAGGAGG - Intronic
938120927 2:128632504-128632526 AGGGCCAAGAGCCCCCAAGCAGG - Intergenic
938139465 2:128784130-128784152 AGGAAAAGGAGGCCACAAGCTGG - Intergenic
938704421 2:133910477-133910499 AGGGGAAGAAGCAGCCAAGATGG + Intergenic
940366325 2:152852421-152852443 GTTGAAAGAAGCCCCCAAGGGGG - Intergenic
940827090 2:158424727-158424749 AGGGAAAGAATCCCCCAAAAAGG + Intronic
940850275 2:158681871-158681893 GGGGAAAGAAGCCCCACAGTAGG + Intronic
940899210 2:159110902-159110924 AGGGAACAAAGCCCCGAAGGAGG - Intronic
941344992 2:164357016-164357038 AGGGAAAGAAGGCACTAAACTGG + Intergenic
941561334 2:167049011-167049033 AGGGAGAGAAGCCAAGAAGCTGG - Intronic
943610182 2:190023021-190023043 AAGGAGAAATGCCCCCAAGCTGG + Intronic
946278635 2:218649818-218649840 AAGGAAAAGAGCCCCCAAGGGGG + Intronic
946396381 2:219445648-219445670 AGGGGAACAAGCCAGCAAGCAGG + Intronic
947109362 2:226701793-226701815 TAGGAAAGAATCCCCAAAGCAGG + Intergenic
947312951 2:228823995-228824017 GGGGAAGACAGCCCCCAAGCTGG + Intergenic
948399353 2:237671968-237671990 AGGAAAAGAAACCCTCAACCCGG - Intronic
948423652 2:237875227-237875249 GGTGAAAGAAGCCCCCAGGGTGG + Intronic
948623968 2:239256226-239256248 AGAGAAAGAAGCCTCCTAGAAGG - Intronic
948861920 2:240756888-240756910 AGGGCCAGCCGCCCCCAAGCAGG - Intronic
948979578 2:241485893-241485915 AGGGAAAGAGGACCCCAGGGAGG - Intronic
1169543283 20:6624249-6624271 AGGAAAAGCAGCCCCCTTGCTGG + Intergenic
1171298493 20:24039452-24039474 ATGGAAAGAAGCCAGCAGGCGGG - Intergenic
1171303458 20:24084324-24084346 AGGGAAAAAAGGCCCTAACCAGG - Intergenic
1171357430 20:24559619-24559641 AGTGAAAGAAGCCTTCAGGCTGG - Intronic
1172664950 20:36592666-36592688 AGGGTTAGAAGCCTCCTAGCTGG + Exonic
1174056363 20:47800923-47800945 AGTGCAGGCAGCCCCCAAGCTGG + Intergenic
1175267345 20:57710432-57710454 GGGGGAGGAAGCCCCCAAGATGG + Intronic
1175625476 20:60485268-60485290 AGGAGAAGAAGCCCAGAAGCAGG - Intergenic
1175920826 20:62449975-62449997 AGGGAAAGGACCCCCCCAGGAGG + Intergenic
1176315916 21:5243748-5243770 AAGGAAAGAAGACCCAGAGCTGG - Intergenic
1177900170 21:26905052-26905074 CAAGAAAGAAGCCACCAAGCTGG + Intergenic
1178392027 21:32206440-32206462 GAGGAAAGAGGCCGCCAAGCAGG - Intergenic
1178618453 21:34153801-34153823 GCGGAGCGAAGCCCCCAAGCAGG - Intergenic
1182225463 22:28794714-28794736 AGGGAAAGAGCCCCCTCAGCAGG + Exonic
1184789992 22:46694523-46694545 AGGGAAAGAGGCGCCCCACCGGG - Intronic
1185134770 22:49063331-49063353 TGGGATAGAAGTCCCCAGGCTGG + Intergenic
949887323 3:8706618-8706640 AGGGAAAGAAGGCTCAGAGCAGG + Intronic
950182711 3:10926666-10926688 AGGGAAGGAGGCTGCCAAGCAGG - Intronic
953622837 3:44547783-44547805 TGGGCCAGAAGCCCCCAACCAGG - Intergenic
954681683 3:52349495-52349517 ATGGCAAGATGTCCCCAAGCAGG + Intronic
955790948 3:62588131-62588153 GGGTAAAGCAGCCCCCTAGCAGG - Intronic
959087560 3:101867820-101867842 AGAGAAAGTGGCACCCAAGCAGG - Intergenic
961808931 3:129510263-129510285 AGGGAAAGAAATGCCCAAGGTGG - Intronic
965474997 3:169146441-169146463 AGGAAAAGAGGCCGACAAGCCGG + Intronic
966354726 3:179067920-179067942 AAGGAAAGAAGTCCCAAAGATGG - Intronic
967786651 3:193504057-193504079 AGGGAAGGAAGCCAACAAGAGGG + Intronic
968484397 4:851936-851958 TGGGAATGAAGCCCCCAGGAGGG + Exonic
968592654 4:1466563-1466585 ATGGACAGAAGCCCCCAGGTGGG - Intergenic
969451546 4:7276665-7276687 AGGGCTGGAAGCTCCCAAGCAGG - Intronic
969629919 4:8330085-8330107 TGGGAGAGAAAGCCCCAAGCTGG + Intergenic
970720712 4:18985659-18985681 ACTGAATGAAACCCCCAAGCAGG - Intergenic
970924815 4:21439183-21439205 AGAGAAAGAAGCCAACAAGAGGG + Intronic
974675299 4:65080190-65080212 AGGGAAGGAAGCGCTCTAGCAGG + Intergenic
976184013 4:82428089-82428111 AGGGAAAGAACCTCCCAAAAAGG - Exonic
976345699 4:83997514-83997536 ATGGGAAGAAGTCACCAAGCAGG - Intergenic
977088548 4:92637714-92637736 AGGGAAATTAGCCCTCCAGCTGG + Intronic
980767879 4:137331823-137331845 AGGGGAAGAATCCACCAAGAGGG - Intergenic
981675872 4:147342333-147342355 AGGGCCAGAAGCCCCCAAAGAGG - Intergenic
983213329 4:164979790-164979812 AGGGAAAGAAACCACCCTGCTGG - Intergenic
985577819 5:681869-681891 AGGGAACGAAGCCTCCTCGCAGG + Intronic
985760707 5:1747150-1747172 ACAGAGAGAAGTCCCCAAGCCGG - Intergenic
989193757 5:38695813-38695835 AGGAAAGGAAGCTTCCAAGCAGG + Intergenic
990031186 5:51261527-51261549 AGGGAAAGAAGCATCCAGGAGGG - Intergenic
995086134 5:108112030-108112052 AGGGAAAGGAGATCCCAAACAGG + Intronic
997951177 5:138243789-138243811 AGGGAATGCAGCCCTCTAGCTGG - Intergenic
999310398 5:150548135-150548157 AGGGACAGCAGCCCGCAAGGTGG - Intronic
1003126537 6:3360689-3360711 AGACAAAGAGGCCCTCAAGCTGG + Intronic
1003256549 6:4480139-4480161 AGGGAAAAAAGCACCTAACCGGG - Intergenic
1003619830 6:7690032-7690054 AGTGAAGGATGCCCTCAAGCTGG + Intergenic
1005899986 6:30209099-30209121 AGGGAAAGAAGAACAGAAGCTGG - Intronic
1006581006 6:35078077-35078099 AAGGAGAGAAGCCTCCAAGGGGG - Intronic
1007074108 6:39055985-39056007 AGTGCAAGAAGCCCTCAGGCAGG + Intronic
1010791504 6:80070282-80070304 AGGGGAAGAATTCCACAAGCAGG + Intergenic
1012511905 6:100011896-100011918 TGAGAAAGAAGCCACCAAGTAGG + Intergenic
1013349615 6:109293479-109293501 AGGAAAAGAAGACCAGAAGCTGG + Intergenic
1015524358 6:134161272-134161294 AGGGAAAGTACCCCCTAATCAGG + Intergenic
1016674601 6:146749434-146749456 AAGCAAAGCAGCCCCCAAACAGG + Intronic
1017757752 6:157544026-157544048 AGGAAACAAAGCCCCCAAGAGGG + Intronic
1019610095 7:1932143-1932165 AGAGAAGGAAGCCCCCAGCCTGG - Intronic
1019613351 7:1947893-1947915 CAGGAAAGCAGCTCCCAAGCAGG + Intronic
1021766437 7:23954223-23954245 AGGGAAAGAAGCATCCAAGTTGG + Intergenic
1022207469 7:28179393-28179415 AGGGAAAGCAGCCACCCTGCGGG + Intronic
1022728788 7:33003984-33004006 GGGTAAAGCAGGCCCCAAGCGGG - Intronic
1023722820 7:43113204-43113226 AAACAAAGAAGCCCCCAAGCGGG + Intronic
1025044860 7:55684005-55684027 GGGTAAAGCAGGCCCCAAGCGGG + Intergenic
1025236635 7:57239231-57239253 AGTGCAGGCAGCCCCCAAGCTGG - Intergenic
1027426855 7:78069810-78069832 AGGGAAAGCAGCCCTCTTGCGGG + Intronic
1028483609 7:91334600-91334622 AGGCAGAGAAGCCACCAAGAGGG - Intergenic
1029174946 7:98657985-98658007 AAGGAAACAAGGCTCCAAGCGGG - Intergenic
1032201487 7:129825709-129825731 AGGGAAAGAGCCCCCAAAACAGG - Intergenic
1032267109 7:130377442-130377464 TGAGAAAGAAGCCACCAGGCTGG - Intergenic
1033053843 7:138031450-138031472 AGGGAGAGAGGCCCCCTGGCTGG + Intronic
1033194901 7:139319414-139319436 AAGGAAAGAAGGCCCCAGACAGG - Intergenic
1035343406 7:158180135-158180157 AGGGTAAGGAGCCCCAAAGTGGG - Intronic
1036668893 8:10766571-10766593 AGGGAAAGAAGCCCCCAAGCTGG - Intronic
1038435556 8:27533258-27533280 AGGGAAAGAAGTTCCCCAGCTGG + Intronic
1038459940 8:27707158-27707180 AGGGAAAGATGCCCATCAGCAGG - Intergenic
1039311285 8:36321051-36321073 AGGGAAAGAAGCCTCCAGCAGGG - Intergenic
1039324932 8:36474687-36474709 AGGGTAAAAAGCCTGCAAGCTGG - Intergenic
1039821373 8:41138348-41138370 AGGGAAGTAAGTCCCCAAGGTGG + Intergenic
1040477089 8:47788286-47788308 AGGGAGAGAAGGAGCCAAGCAGG + Intronic
1040602716 8:48899835-48899857 AGAGAAAGAAGCCCCGCTGCTGG - Intergenic
1042704200 8:71649540-71649562 AGGGAGTGAAGGCTCCAAGCAGG + Intergenic
1043818281 8:84830414-84830436 AGGGAAGGAAGTCCCCAAGGTGG + Intronic
1044748549 8:95394702-95394724 AGGGAAAGAGGCCACTAAGAGGG - Intergenic
1046340456 8:112847197-112847219 AGGGCAAGAAGCATCCAAGGGGG - Intronic
1046385826 8:113507902-113507924 TAGGAAAGAAGCCCTCTAGCAGG + Intergenic
1046956101 8:120064373-120064395 AGGGCAGGAAGACTCCAAGCGGG - Intronic
1047219376 8:122907343-122907365 AGGGCAGGAAGACTCCAAGCGGG + Intronic
1048198740 8:132353983-132354005 AGGGAAAGAAGCCCTGAGCCAGG + Intronic
1048507200 8:135032370-135032392 AGGGAAAGAAGCCTGCCAGGTGG - Intergenic
1049594339 8:143476551-143476573 CGGGCAAGCAGCCCCCAAGGTGG + Intronic
1050074083 9:1845863-1845885 AGGGGAAGAATCCCCCAAGGAGG + Intergenic
1052334448 9:27305594-27305616 AGGGAAAGAGGACACCAAGCAGG + Intergenic
1053532870 9:38899250-38899272 AGGCTCAGAAGCCCCCAAGCAGG + Intergenic
1054205096 9:62123679-62123701 AGGCTCAGAAGCCCCCAAGCAGG + Intergenic
1054345612 9:63912285-63912307 AAGGAAAGAAGACCCTGAGCTGG - Intergenic
1054633263 9:67464691-67464713 AGGCTCAGAAGCCCCCAAGCAGG - Intergenic
1057820844 9:98329427-98329449 AGGAGAAGGAGCCCCCAGGCAGG - Intronic
1059428245 9:114234552-114234574 AGGGGAAGCAGCTCCCAATCTGG + Intronic
1060428585 9:123527238-123527260 AGAGAAAGAAGCCGCCAAGGAGG - Intronic
1060783860 9:126433630-126433652 AGAGAATGAAGCTTCCAAGCAGG - Intronic
1061008441 9:127941715-127941737 AGAGAGAGAAGCCCCCATCCCGG + Exonic
1061074240 9:128331503-128331525 TGGGAGAGAACACCCCAAGCTGG + Intronic
1185503318 X:615168-615190 AGAAACAGGAGCCCCCAAGCCGG + Intergenic
1185503422 X:615820-615842 AGAAAGAGGAGCCCCCAAGCCGG + Intergenic
1185503487 X:616241-616263 AGAAACAGGAGCCCCCAAGCCGG + Intergenic
1186275131 X:7930201-7930223 AGGAAAAGGAGCCATCAAGCTGG - Intergenic
1190875461 X:54456925-54456947 GAGGAAAGAAGCCCCGAGGCCGG - Intronic
1192787148 X:74346721-74346743 AGGGGAAGAAGGCCCCAAATTGG + Intergenic
1194198285 X:90923614-90923636 AAGGAAAGGAGACCACAAGCAGG + Intergenic
1194895674 X:99436311-99436333 AGGAAAAGAAGACCCCAGCCTGG - Intergenic
1195520014 X:105820158-105820180 AGGAAAAGAAGTCCCGAAGTTGG + Intergenic
1196768345 X:119270078-119270100 AGGGAAACAAGCCCCCACTTGGG - Intergenic
1198008106 X:132519583-132519605 AGGGAAAGAACAGCCCAAGCAGG - Intergenic
1198145046 X:133847335-133847357 AGGGAAACAAACCTTCAAGCAGG - Intronic
1199369889 X:147035171-147035193 GTGGAACAAAGCCCCCAAGCTGG + Intergenic
1200120195 X:153786544-153786566 AGGGACAAAAGCCCACCAGCGGG + Intronic
1200328062 X:155263887-155263909 AAGGAAAGAAGCGCCCTGGCAGG - Intronic
1200543451 Y:4489214-4489236 AAGGAAAGGAGACCACAAGCAGG - Intergenic
1201447775 Y:14077040-14077062 AGGAAAAGGAGCCATCAAGCTGG + Intergenic
1202018378 Y:20435461-20435483 AGGCAAAGAAGGGCCCAAGGTGG - Intergenic
1202266871 Y:23028836-23028858 AGGAAAATAAGGCACCAAGCTGG + Intergenic
1202419864 Y:24662581-24662603 AGGAAAATAAGGCACCAAGCTGG + Intergenic
1202450922 Y:25007503-25007525 AGGAAAATAAGGCACCAAGCTGG - Intergenic