ID: 1036668900

View in Genome Browser
Species Human (GRCh38)
Location 8:10766586-10766608
Sequence CTTTCCCTCAGCTGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036668884_1036668900 13 Left 1036668884 8:10766550-10766572 CCTCCTCCCTGAACCAACAGGCC 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668886_1036668900 7 Left 1036668886 8:10766556-10766578 CCCTGAACCAACAGGCCAGCTTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668882_1036668900 26 Left 1036668882 8:10766537-10766559 CCGCGTGTCTCAGCCTCCTCCCT 0: 1
1: 1
2: 10
3: 113
4: 1696
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668885_1036668900 10 Left 1036668885 8:10766553-10766575 CCTCCCTGAACCAACAGGCCAGC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668887_1036668900 6 Left 1036668887 8:10766557-10766579 CCTGAACCAACAGGCCAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668892_1036668900 0 Left 1036668892 8:10766563-10766585 CCAACAGGCCAGCTTGGGGGCTT 0: 1
1: 1
2: 0
3: 21
4: 173
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data
1036668893_1036668900 -8 Left 1036668893 8:10766571-10766593 CCAGCTTGGGGGCTTCTTTCCCT 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036668900 Original CRISPR CTTTCCCTCAGCTGGGGGTG GGG Intronic
No off target data available for this crispr