ID: 1036669510

View in Genome Browser
Species Human (GRCh38)
Location 8:10772060-10772082
Sequence CTAATCCCACAAAAAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036669510 Original CRISPR CTAATCCCACAAAAAGAACG TGG (reversed) Intronic
911421799 1:97651964-97651986 TTAAGCCCACAAAAAGAAAATGG + Intronic
913502458 1:119483695-119483717 GTAATCCCCCAAAAAGAAACGGG + Intergenic
919075079 1:192803460-192803482 CAGATCCCCCAAAAAGAATGAGG + Intergenic
921988508 1:221338466-221338488 CTTATCCCACAGTAAGAAAGAGG - Intergenic
1066093169 10:32046517-32046539 ATAATCCCACTAAAATAACCTGG + Intronic
1068840778 10:61611645-61611667 CTAACCCCAAAAAAGGGACGGGG + Intergenic
1078968821 11:16381278-16381300 CTTATTCCAGAAAAAGAACTGGG + Intronic
1080527769 11:33144128-33144150 CTAATTCCACTAAAAAAAAGGGG - Intronic
1080943898 11:36949799-36949821 CTACTCCCACAGAGAGAACCAGG + Intergenic
1081602370 11:44504070-44504092 CTCATCCCGAAAAAAGAAAGAGG + Intergenic
1087403881 11:97704103-97704125 CTAATCTCAAAAACAGAACGTGG - Intergenic
1088443731 11:109901158-109901180 CTAATACCACAAAAACAGCATGG + Intergenic
1094508381 12:31080660-31080682 TTACACCCACAAAAAGAAAGTGG - Intronic
1103800558 12:123534300-123534322 CTCATCCCAGGAAGAGAACGGGG + Intergenic
1104329327 12:127829598-127829620 CTAATGCCACAAAAAAACCCAGG + Intergenic
1105867041 13:24470327-24470349 CAAAGCCCACAAAACGAAAGGGG - Intronic
1106972888 13:35165090-35165112 CTAATACGGCAACAAGAACGTGG - Intronic
1109290243 13:60465100-60465122 CTATTCCCACAAAAGGAATTAGG - Intronic
1113851402 13:113420775-113420797 CACTTCCCACAAAACGAACGGGG + Intergenic
1127943592 15:63726814-63726836 CTAATCTCATAACATGAACGCGG - Intronic
1131645795 15:94341914-94341936 CTCATCCCACCTAAAGAAGGAGG + Intronic
1132134305 15:99319616-99319638 CTAGTCACACACAAAGCACGAGG + Intronic
1135716733 16:24776910-24776932 CTAATCCCAACAAAAGAAAAGGG - Intronic
1140770701 16:78201580-78201602 ATAATCCCACAAACACAACCTGG - Intronic
1152506738 17:80754309-80754331 CGAATGACACAAAAAGAAGGCGG - Intronic
1152720509 17:81921331-81921353 CTAAACCCAAAAAACGAACACGG + Exonic
1156099056 18:33571970-33571992 ATAAGCCCACAAACAGAAAGGGG + Intergenic
925054344 2:845309-845331 ATAATCCTGAAAAAAGAACGAGG + Intergenic
930089899 2:47524412-47524434 TAAATCTCACAAAAAGAATGTGG + Intronic
930717555 2:54607065-54607087 CTTACCCCAAAAAAAGAAAGAGG - Intronic
930994718 2:57702372-57702394 CTATTCCCAGTAAAAGAACTAGG + Intergenic
933373885 2:81453667-81453689 TTAATCTCACAAAAGGAAGGAGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
938274448 2:130005559-130005581 ATTATCCCACAAAAAGCAAGAGG - Intergenic
940235609 2:151508097-151508119 CTATTCCCAGAAAAAGTACAAGG - Exonic
944518542 2:200539013-200539035 CTAAGCCCATAAAAAGAATTTGG + Intronic
1178461910 21:32810135-32810157 CTATTCACTCAAAAAGAAGGGGG - Intronic
1183244209 22:36681204-36681226 CTAAACCAACAGAAAGAAGGTGG - Intronic
1183359810 22:37377588-37377610 TTAATCCCACAAGAAGTCCGAGG + Intronic
952026717 3:29091604-29091626 TTACTCCCTCAAAAAGAACTTGG - Intergenic
952815726 3:37445947-37445969 CTAATCCCTCCAAAAGAGCAAGG - Intergenic
954180937 3:48880869-48880891 CTAATCCCAGAAAGAAAAGGAGG - Intronic
957114225 3:76003774-76003796 CTAATCCCTCACGGAGAACGTGG + Intronic
958002333 3:87766476-87766498 ATAATCACACAATAAGAACAAGG + Intergenic
965385514 3:168041271-168041293 CAAAGCCCACAATAACAACGTGG + Intronic
967664732 3:192157470-192157492 CTAATCCTACAAAGAGAAAATGG - Intronic
967726569 3:192867911-192867933 CTAATCACACAAAAAGGCTGGGG + Intronic
980152419 4:129063442-129063464 CTACCCCCACAAAAAAAACATGG - Intronic
981102031 4:140839807-140839829 CTGATGCCACAAAAACAAGGAGG + Intergenic
982545528 4:156727900-156727922 TTAATACTACAAAAAGAACTTGG + Intergenic
987253557 5:16125014-16125036 CTAATCAAACAATAAGAATGTGG - Intronic
988827040 5:34948087-34948109 CTCTTCCCACAAAAAGAATATGG - Intronic
989333495 5:40287663-40287685 TTAATCCCACAAAAATACCCTGG - Intergenic
991184549 5:63792204-63792226 CTAATCCTACTAAAAAAACAGGG - Intergenic
992635407 5:78721639-78721661 CTAATTCCAAAAAAATAACACGG + Intronic
994678117 5:102850508-102850530 CTACTCACACAAAAAGATGGAGG - Intronic
995167830 5:109067377-109067399 AAAATCCCACAAAAAGTAAGAGG - Intronic
997103340 5:130992579-130992601 ATGATCCCACAAAAAGAGCCAGG + Intergenic
997352066 5:133238305-133238327 CTCCTCCCACAAAGAGAACCAGG - Intronic
999438084 5:151580060-151580082 CTATTCCCAGAAAAAGGAAGGGG + Intergenic
1001014967 5:168132144-168132166 CTAATCCCAGAACAAGGACTGGG + Intronic
1001392985 5:171395288-171395310 AAAATCCCACAAAAAAAACCAGG - Intronic
1002965392 6:1961087-1961109 CTAACAGCACAATAAGAACGTGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1008035080 6:46736654-46736676 CTAATCCCACACTAAAAAGGTGG + Intergenic
1012589479 6:100962548-100962570 ATAATCCAACAAAAAGAACAAGG + Intergenic
1017702627 6:157090380-157090402 CTAATGCCTAAAAAAGAATGCGG - Intronic
1018898434 6:168037614-168037636 TTAATCCCACAACAAGAAATGGG - Intronic
1023773833 7:43584118-43584140 CTACTCCCACAAAAAAAGGGTGG - Intronic
1024759556 7:52578991-52579013 ATAATAGCACAAAAAGCACGAGG - Intergenic
1028532115 7:91849492-91849514 CTAATCCCAAAACAATAACATGG + Intronic
1028783467 7:94764700-94764722 CTAATGCCACAAGAAGCAAGAGG + Intergenic
1030867635 7:114719389-114719411 GTAATTCCTCAAAAAGAAAGAGG - Intergenic
1032597196 7:133253357-133253379 CTAACCCCAGAAAAAAAAGGTGG - Intronic
1036669510 8:10772060-10772082 CTAATCCCACAAAAAGAACGTGG - Intronic
1040618855 8:49066604-49066626 CTCATCCCCCAAGAAGAAGGAGG + Intronic
1041571846 8:59346151-59346173 CTTATCCCACAAACAGGACATGG - Intergenic
1043065335 8:75562736-75562758 CAAATCCCACAAATAGTATGTGG - Intronic
1044512934 8:93104659-93104681 CTAATCCCAGTAAAAGAAATAGG - Intergenic
1061747773 9:132752882-132752904 TTAATCCCACATAAAGCACTTGG + Intronic
1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG + Intergenic
1187204050 X:17165323-17165345 CTACTGCCACCAAAAGAACCAGG + Intergenic
1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG + Intergenic
1187545015 X:20242064-20242086 TTAATCCCACTAAAAGAAAAGGG + Intronic
1190167206 X:48083118-48083140 AAAATCCCACAGAAAGAAGGAGG + Intergenic
1194169136 X:90560295-90560317 CTAATCCCACAAAGACATCTGGG - Intergenic
1195993757 X:110710448-110710470 CCAATCCCAGAAACAGAATGGGG + Intronic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic