ID: 1036676339

View in Genome Browser
Species Human (GRCh38)
Location 8:10837085-10837107
Sequence GTTCCCACCATTCGCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036676331_1036676339 25 Left 1036676331 8:10837037-10837059 CCTGACTGCTATCCTTTGAAAGG 0: 3
1: 9
2: 12
3: 31
4: 132
Right 1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG No data
1036676336_1036676339 2 Left 1036676336 8:10837060-10837082 CCTGTTCATAACAGGGAACTCAA 0: 1
1: 0
2: 2
3: 8
4: 121
Right 1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG No data
1036676333_1036676339 13 Left 1036676333 8:10837049-10837071 CCTTTGAAAGGCCTGTTCATAAC 0: 1
1: 0
2: 2
3: 6
4: 92
Right 1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036676339 Original CRISPR GTTCCCACCATTCGCAGAAC TGG Intronic
No off target data available for this crispr