ID: 1036678367

View in Genome Browser
Species Human (GRCh38)
Location 8:10852910-10852932
Sequence CTGGTCTCACAAATGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036678367_1036678374 19 Left 1036678367 8:10852910-10852932 CCCTTCTTCATTTGTGAGACCAG No data
Right 1036678374 8:10852952-10852974 GTGCACGCTGCAGCCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036678367 Original CRISPR CTGGTCTCACAAATGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr