ID: 1036683932

View in Genome Browser
Species Human (GRCh38)
Location 8:10895702-10895724
Sequence CCCGAGGGGACCCCCGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036683921_1036683932 0 Left 1036683921 8:10895679-10895701 CCTCCACCTGCCCACCAGTGAGG No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data
1036683924_1036683932 -6 Left 1036683924 8:10895685-10895707 CCTGCCCACCAGTGAGGCCCGAG No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data
1036683923_1036683932 -3 Left 1036683923 8:10895682-10895704 CCACCTGCCCACCAGTGAGGCCC No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data
1036683919_1036683932 19 Left 1036683919 8:10895660-10895682 CCTAGAGTTGGGGGCTCCTCCTC No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data
1036683920_1036683932 3 Left 1036683920 8:10895676-10895698 CCTCCTCCACCTGCCCACCAGTG No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data
1036683928_1036683932 -10 Left 1036683928 8:10895689-10895711 CCCACCAGTGAGGCCCGAGGGGA No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data
1036683918_1036683932 26 Left 1036683918 8:10895653-10895675 CCTGCTTCCTAGAGTTGGGGGCT No data
Right 1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036683932 Original CRISPR CCCGAGGGGACCCCCGAGTC AGG Intergenic
No off target data available for this crispr