ID: 1036686317

View in Genome Browser
Species Human (GRCh38)
Location 8:10913990-10914012
Sequence GACTCTCCTTTGGTCAGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036686306_1036686317 29 Left 1036686306 8:10913938-10913960 CCAGCAGCAGGGCTTGGCAGCCT 0: 1
1: 0
2: 5
3: 45
4: 298
Right 1036686317 8:10913990-10914012 GACTCTCCTTTGGTCAGGTCCGG No data
1036686313_1036686317 9 Left 1036686313 8:10913958-10913980 CCTGGGGTGCAAGAGGCTGGGAA 0: 1
1: 0
2: 1
3: 32
4: 299
Right 1036686317 8:10913990-10914012 GACTCTCCTTTGGTCAGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036686317 Original CRISPR GACTCTCCTTTGGTCAGGTC CGG Intronic
No off target data available for this crispr