ID: 1036687007

View in Genome Browser
Species Human (GRCh38)
Location 8:10918460-10918482
Sequence TGCCATGGCCAAGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036687007_1036687015 11 Left 1036687007 8:10918460-10918482 CCATGCCCAGCTTGGCCATGGCA 0: 1
1: 0
2: 4
3: 34
4: 355
Right 1036687015 8:10918494-10918516 CCACTCCATCCCGTCAGCAGTGG No data
1036687007_1036687016 15 Left 1036687007 8:10918460-10918482 CCATGCCCAGCTTGGCCATGGCA 0: 1
1: 0
2: 4
3: 34
4: 355
Right 1036687016 8:10918498-10918520 TCCATCCCGTCAGCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036687007 Original CRISPR TGCCATGGCCAAGCTGGGCA TGG (reversed) Intronic
900165053 1:1241221-1241243 TGCTGTGGCCAAGCAGGGCAGGG + Intergenic
900185757 1:1332470-1332492 CGGCATGGCCCAGATGGGCACGG + Exonic
900299396 1:1969391-1969413 GGGCAGGGCTAAGCTGGGCAAGG - Intronic
900530665 1:3151423-3151445 GCCCATGGCCTGGCTGGGCAAGG - Intronic
900662193 1:3790348-3790370 TCCCAAGGCCAAGCTGCACAGGG - Intronic
900915500 1:5635418-5635440 TGCCATGGACACGATGGCCACGG - Intergenic
900941385 1:5800827-5800849 TGGCATGGACTAGATGGGCAAGG + Intergenic
901036507 1:6339127-6339149 TGCCATGGATGAGCTGGCCACGG + Intronic
901226052 1:7613619-7613641 TCCCATTGCCAAGCAGGGAATGG + Intronic
902420678 1:16277432-16277454 TTCCATATCCAGGCTGGGCATGG + Intronic
903014634 1:20353975-20353997 GGCCAAGGGCAAGCTGGGCCTGG + Exonic
903215685 1:21842202-21842224 TGCCATGGGCAAGGGGGGAAGGG - Intronic
903481845 1:23659357-23659379 TTCCACGTCCAGGCTGGGCATGG + Intergenic
904494552 1:30879263-30879285 TGCCCTGGCTGGGCTGGGCAGGG - Intronic
904576560 1:31508900-31508922 AGACCTGGCCAGGCTGGGCAGGG + Intergenic
905098020 1:35492223-35492245 TATCATGACCAAGCTGGGCGCGG + Intronic
905203189 1:36327725-36327747 TGCCGTGGCCAAGCCAGGCCAGG + Exonic
906858554 1:49333799-49333821 TACCATGGCCAAACTGAACAAGG - Intronic
907410272 1:54278782-54278804 GGCCTTGGCCAAGCAGGGGAAGG + Intronic
907806152 1:57822381-57822403 TGCCATGGCCACACTGGTTAGGG + Intronic
908596471 1:65693673-65693695 TGCCATGGCCCAGATGTTCATGG - Intergenic
910609920 1:89129661-89129683 TGCCATGGCAAAACTGGGAAGGG + Intronic
911025171 1:93427886-93427908 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
912656413 1:111489879-111489901 TGCCATGGTCAAGCTGGACATGG - Intronic
912919898 1:113855852-113855874 TGCCTTAGAGAAGCTGGGCAGGG + Intronic
915230777 1:154443910-154443932 TCCCCTGGACAAGCAGGGCAGGG - Intronic
915283158 1:154836489-154836511 TGCCAGGGCAGAGCTGAGCAGGG + Intronic
916713631 1:167432785-167432807 TGCCATGGCCAAGCAAGGCATGG + Intronic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
919074504 1:192797409-192797431 TGGCAAGGCCAGGCTGGGCTGGG - Intergenic
919691086 1:200529024-200529046 TGCTCAGTCCAAGCTGGGCATGG - Intergenic
919812495 1:201417861-201417883 TCCCAAGGCCCAGCTGGGCAGGG - Intronic
922079673 1:222283632-222283654 GCCCATGGCCAAGCAGGTCAAGG + Intergenic
922722461 1:227905875-227905897 TGCCCTGGCCAAGCTGCACAGGG + Intergenic
922739658 1:228007972-228007994 TTCCATCGCCAGGCTGGGGAGGG - Intronic
924837873 1:247672601-247672623 AGCCATGACCATGCTGAGCAAGG + Exonic
1065553185 10:26889095-26889117 TCCTGTGGTCAAGCTGGGCATGG + Intergenic
1065830485 10:29609828-29609850 TGCCAAGGGCAAGCCAGGCATGG - Intronic
1066508345 10:36067538-36067560 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1067251119 10:44587775-44587797 TGCTATGGCAAGGCTGGGGAGGG + Intergenic
1068657916 10:59593521-59593543 TGGCATGGCTAAGCTGTGCTGGG - Intergenic
1068669684 10:59710125-59710147 TGCCCTGGCCAAGCCCGCCAAGG + Intronic
1069212626 10:65780221-65780243 TGCCATGGGCAAGCCAGGCATGG - Intergenic
1069847819 10:71384804-71384826 TGCCTGGCCCAGGCTGGGCATGG + Intergenic
1073258546 10:102171416-102171438 TTACATGGTCATGCTGGGCACGG - Intergenic
1074077424 10:110141867-110141889 TGCCAAAGCCAAGCTGAGCATGG + Intergenic
1074550865 10:114440987-114441009 TCCCATGGCCAGGCTGAGCATGG - Intronic
1075083097 10:119396943-119396965 TGGCAGGGCCAAGATGGGGATGG + Intronic
1075672154 10:124270196-124270218 TGCCACGTCCAGGTTGGGCATGG + Intergenic
1076705126 10:132297261-132297283 TGCCCTGGACACGCTGGGGATGG - Intronic
1076897209 10:133318557-133318579 GGCCAGGGCCCAGCTGTGCATGG + Intronic
1077184311 11:1229486-1229508 TGCCATGAGCCAGCTGGGCATGG + Intronic
1077354614 11:2109321-2109343 TGCCCACGCCCAGCTGGGCAGGG + Intergenic
1077392868 11:2308099-2308121 TGCCCTGCCCCTGCTGGGCAGGG + Intronic
1077669411 11:4144234-4144256 TGCCATAACCAAGCTGGAAATGG - Intergenic
1078413154 11:11144024-11144046 TGCCAGGGACAGGCTGAGCAGGG - Intergenic
1078924911 11:15865773-15865795 TGGCATGGCCTGGCTGGCCATGG - Intergenic
1083849274 11:65355593-65355615 TGCCAGGGCAGAGCTGGGGAGGG - Intronic
1084036584 11:66515106-66515128 TGCCATCACTAGGCTGGGCACGG - Intronic
1084757212 11:71247540-71247562 TGCCATGGCCCTGCTGGGCTGGG - Intronic
1084874331 11:72119732-72119754 TACCGTTGTCAAGCTGGGCATGG + Intronic
1084894855 11:72258599-72258621 TGCCAGGGGCAAGCTGGGTGTGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085276148 11:75301585-75301607 AGCCATGGCTCAGCTGGGTAGGG + Intronic
1086967937 11:93049467-93049489 TGCCACGGTCATTCTGGGCATGG - Intergenic
1089684720 11:120139401-120139423 CTCCAAGGCCAGGCTGGGCAGGG + Intronic
1090649280 11:128792209-128792231 TGCCATTGCCTAGGTGGGGAGGG - Intronic
1091700296 12:2654499-2654521 TCCCAAGGCCAAACTTGGCAGGG + Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1092176284 12:6410016-6410038 TGCCATGTCCAAGTTGGAAAGGG + Intergenic
1092732063 12:11544364-11544386 TGAACTGGGCAAGCTGGGCATGG - Intergenic
1095358484 12:41306232-41306254 TACCATGGCTCTGCTGGGCAGGG + Intronic
1097482464 12:60147254-60147276 TGCCATGTACAAGCAGTGCAGGG + Intergenic
1098951727 12:76646163-76646185 TGCCAAGGCCAAGCCAGGCATGG - Intergenic
1101528745 12:105555905-105555927 TGGCCTGGCCCAGCCGGGCAGGG - Intergenic
1102346337 12:112163512-112163534 TCCCAGGGCCAGGCTGGGCGGGG - Intronic
1102591206 12:113958151-113958173 GGCCATGGACACGGTGGGCATGG - Intronic
1104093760 12:125537688-125537710 TGTCTTGGCCAGGCTGAGCAGGG + Intronic
1104280791 12:127374530-127374552 TGTCTTGGCCAGGCTGAGCAGGG - Intergenic
1104780636 12:131417743-131417765 TGGCAGGCCCAAGCTGGTCAAGG - Intergenic
1106791204 13:33156270-33156292 AGCCCTGGCCATGTTGGGCACGG + Intronic
1107726623 13:43305955-43305977 TGCGCAGGCCAGGCTGGGCAGGG - Intronic
1109944544 13:69416088-69416110 TGCCAAGGCCAAACTGGCTATGG + Intergenic
1110029169 13:70584187-70584209 CGCCATTGGCAAGCTGGGCTGGG - Intergenic
1110310567 13:74044554-74044576 TACCAATGGCAAGCTGGGCATGG + Intronic
1110810796 13:79808723-79808745 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1111595532 13:90404988-90405010 TGCCAAGGACATGCTAGGCATGG - Intergenic
1113594338 13:111520732-111520754 GGGGAAGGCCAAGCTGGGCAGGG - Intergenic
1113611080 13:111645467-111645489 TTCCAGGACCAGGCTGGGCATGG + Intronic
1113871717 13:113563949-113563971 TGTCGTGGCCATGCTGGACACGG + Intergenic
1114588081 14:23833093-23833115 TTCCATGGTCAGGCTGGGCGTGG - Intergenic
1115262838 14:31471111-31471133 TGACATGGCCCAACTTGGCATGG + Intergenic
1118816420 14:69317429-69317451 CTCCATGGCCAAGCCTGGCATGG + Intronic
1119474363 14:74918644-74918666 GGCCATGGCCAAGGAGGGCTCGG - Intronic
1120458724 14:84765960-84765982 AGCTATGACCAGGCTGGGCATGG - Intergenic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1122203155 14:100134754-100134776 TGCCATGGCAGAGCTGGCCCTGG + Intronic
1122296433 14:100708830-100708852 TGACATGGTGAAGGTGGGCAGGG + Intergenic
1122625660 14:103084294-103084316 TGCCGGGGCCAGGCTGGGGAGGG - Intergenic
1122629309 14:103100011-103100033 TGCCAGGCCGCAGCTGGGCACGG - Intergenic
1122629566 14:103101341-103101363 TGCAATTGTCCAGCTGGGCATGG - Intronic
1202905458 14_GL000194v1_random:68946-68968 AGGCAGGGCCGAGCTGGGCAAGG - Intergenic
1124609802 15:31200769-31200791 GGCCATGGCCCAGCTTGTCAAGG + Intergenic
1124916061 15:33975639-33975661 TACCAGGTCCCAGCTGGGCACGG + Intronic
1125329029 15:38564610-38564632 GGCCATGGGCACCCTGGGCAAGG - Exonic
1125381914 15:39095171-39095193 TGAGATGACTAAGCTGGGCAAGG - Intergenic
1126215340 15:46147188-46147210 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1127135907 15:55923355-55923377 TTAGATGGCCAGGCTGGGCATGG + Intronic
1127834186 15:62776898-62776920 AGCCATGAGCAAGGTGGGCATGG + Exonic
1128812095 15:70580226-70580248 TGCCAAGGCGAAGCTGGGCTTGG + Intergenic
1129104415 15:73296307-73296329 GGCCAGGGAGAAGCTGGGCAGGG - Intronic
1129877882 15:78988630-78988652 GGCCCTGGCCAAGGTGGTCAGGG + Intronic
1130925996 15:88386358-88386380 TGCCGGAGCCAAGCTGGACATGG - Intergenic
1131777076 15:95814512-95814534 TGGCCTGGCCTAGCTAGGCAGGG - Intergenic
1133919335 16:10138075-10138097 TGTCATCACCAAGGTGGGCATGG + Intronic
1134280002 16:12808906-12808928 TGGCAAGACCAGGCTGGGCATGG - Intergenic
1136232987 16:28898360-28898382 GGCCAGGGCCAAGCAGCGCAGGG - Exonic
1136233716 16:28902484-28902506 GGCCATGGACAGGCTGGCCAAGG - Intronic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1138487061 16:57352656-57352678 TGCCATGGCCAAAAAGGACACGG - Intergenic
1139463504 16:67141554-67141576 TGCCAAGGGCAAGCCAGGCATGG + Intronic
1140326088 16:74005082-74005104 TGGCATGGGCAGGCTGGGTAGGG + Intergenic
1140774923 16:78240752-78240774 TGCGAGGGCCAGGCTGGGCCAGG + Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1142108877 16:88320672-88320694 TCTCATGGTCAGGCTGGGCATGG - Intergenic
1142135116 16:88448414-88448436 TGCCTGGGCCACCCTGGGCAGGG - Intergenic
1142496756 17:310115-310137 AGCCATGGGGAGGCTGGGCAGGG - Intronic
1142574201 17:895438-895460 TGCCATGACACAGCTGGGTATGG + Intronic
1144476932 17:15596513-15596535 TGCCATGGCCCAGTTGGTAAAGG - Exonic
1144742896 17:17594020-17594042 AGCCTGGGCCAGGCTGGGCATGG + Intergenic
1144921309 17:18766841-18766863 TGCCATGGCCCAGTTGGTAAAGG + Exonic
1145219533 17:21076830-21076852 TCCCCTGGCCAAGATGGGCTGGG - Intergenic
1146860241 17:36291221-36291243 AACCATGACCAGGCTGGGCATGG - Intronic
1147090567 17:38095315-38095337 AACCATGACCAGGCTGGGCATGG - Intergenic
1147106646 17:38225211-38225233 AACCATGACCAGGCTGGGCATGG + Intergenic
1147576518 17:41603373-41603395 ACCCATGCCCAGGCTGGGCATGG + Intergenic
1148070951 17:44908208-44908230 TGCGATGGGGAAGCCGGGCATGG - Intronic
1148422876 17:47563320-47563342 AACCATGACCAGGCTGGGCATGG - Intronic
1148430435 17:47638709-47638731 GCACATGTCCAAGCTGGGCACGG + Intergenic
1148539282 17:48466952-48466974 TCCCAAGGCCAAGCTGGAAATGG - Intergenic
1149009091 17:51836476-51836498 AGCCATGGCCAAGCTGTCTAAGG + Intronic
1149363088 17:55914224-55914246 AGGCATGGCCAGGCTGGGCTGGG + Intergenic
1151320405 17:73349186-73349208 TGCTATGGCCATGCTGGGCCTGG + Intronic
1151426397 17:74033594-74033616 TGTCATGGCAAAGCTGGACTTGG - Intergenic
1152074757 17:78152045-78152067 AGCCAAGCCCAGGCTGGGCACGG - Intronic
1152228113 17:79102022-79102044 TGCCAAGGCCCACCTAGGCATGG + Intronic
1152419982 17:80187545-80187567 TGCAATGGTCCAGCTGGGCTGGG - Intronic
1152997833 18:424895-424917 TGCCATGTCACAGCTGAGCAGGG + Intronic
1153214542 18:2807652-2807674 TGAAATGACCAGGCTGGGCACGG + Intergenic
1153332073 18:3883702-3883724 GGCAAAGGCCAGGCTGGGCAAGG + Intronic
1153690223 18:7585036-7585058 TGCCAAGGCCAGCCTGGGGAAGG - Intronic
1154309208 18:13254431-13254453 TTCCCTGGCCCAGCTGAGCAGGG + Intronic
1154348686 18:13565370-13565392 TGCCAGCGCCAAGCTGGGCCAGG + Intronic
1155318122 18:24592445-24592467 TTCCATGGCCAAGCTGAGCTTGG + Intergenic
1157209249 18:45727378-45727400 TGCCAGGGCCAAGCTTAGCCGGG - Exonic
1157480713 18:48051825-48051847 TTCCATGGCCAACCCGGCCAGGG - Intronic
1157483795 18:48073071-48073093 TTCCATGGCCAAACTGGGCCTGG - Intronic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1160199137 18:76781759-76781781 TGCCAAGTCTAGGCTGGGCATGG + Intergenic
1160431139 18:78813365-78813387 AGCCATGGCCACGCTGGCCCAGG - Intergenic
1160870906 19:1277423-1277445 GGCCATGGCCCCACTGGGCAGGG + Intronic
1161268709 19:3377483-3377505 TGCCTTGACCAGGCTGGGCTGGG - Intronic
1161780348 19:6287514-6287536 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1161822814 19:6541215-6541237 AGATATCGCCAAGCTGGGCATGG + Intergenic
1161865541 19:6829658-6829680 GGGCATGGCCAAGTTGGCCAAGG + Intronic
1162057301 19:8072196-8072218 TGCCTGGGCCAGGATGGGCAGGG + Exonic
1162551379 19:11360310-11360332 TTCCAGGGAAAAGCTGGGCATGG + Intronic
1162585669 19:11556833-11556855 AGGCATGCCGAAGCTGGGCATGG - Intronic
1163021406 19:14482775-14482797 TGCCATGGGCCAGCTGGGTGTGG + Exonic
1163383740 19:16986221-16986243 TGCTGGGGCCAGGCTGGGCATGG - Intronic
1163783095 19:19260816-19260838 TGGCATGGTCAAGCTGGACCTGG - Exonic
1165819180 19:38663740-38663762 AGACATGGCCAAGATGAGCATGG - Intronic
1165870337 19:38967854-38967876 TGGCATTTCCCAGCTGGGCATGG - Intronic
1167592074 19:50409519-50409541 GGCCAAGGCCGAGCTGGCCAAGG + Exonic
1167614507 19:50524996-50525018 CTCCATGGCAGAGCTGGGCAGGG + Intronic
1168135954 19:54352085-54352107 AGCCCTGGGCCAGCTGGGCAAGG - Exonic
1168493378 19:56829883-56829905 TGCCATGGAGAAGCTGGCCTGGG - Intronic
925332040 2:3065997-3066019 TGCCATTCCCAAGCTCGGCTTGG - Intergenic
926215111 2:10901461-10901483 TGCCAAGGCCAAGAAGAGCAGGG - Intergenic
926659802 2:15452303-15452325 TATCATGGCCAGGATGGGCACGG + Intronic
926798725 2:16640399-16640421 TGCCATGCCCCAGCTGGCCCTGG + Intronic
927533718 2:23836123-23836145 TGCCAGGGGCAAGCCAGGCATGG + Intronic
927929658 2:27036031-27036053 TGCCACGGCAAACCTAGGCAAGG + Exonic
931321421 2:61177535-61177557 CGCCATGGCCAAGTGGGGCCAGG + Exonic
931440625 2:62287770-62287792 CAACATGGCAAAGCTGGGCATGG - Intergenic
932749782 2:74363941-74363963 TGCCATCTCCAAGAAGGGCACGG + Intronic
934567114 2:95347016-95347038 TGCCATGGGCATCCAGGGCATGG + Intronic
935446700 2:103164932-103164954 TGCCATGACAAAGCTGGGAAAGG + Intergenic
938096313 2:128466502-128466524 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
938240766 2:129740988-129741010 AGGCATGGCAGAGCTGGGCAGGG + Intergenic
938721974 2:134075443-134075465 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
939783500 2:146478592-146478614 TGTCATGACCTAGCTGGGCACGG - Intergenic
943760862 2:191607138-191607160 TACCATTGCCAAGATGGGCACGG - Intergenic
945201859 2:207289836-207289858 CACCATGGCTGAGCTGGGCAGGG - Intergenic
946285194 2:218697472-218697494 GGCCATGGCCAGGCTCAGCAGGG - Exonic
946358857 2:219206971-219206993 CTCCATCGCCAAGCCGGGCAGGG - Exonic
946738052 2:222774208-222774230 TGCCTTGCCCAAGATGGGCAAGG + Intergenic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
948035171 2:234852640-234852662 TGCCTTGGTGAAGCTGGGAAGGG - Intergenic
948553426 2:238791375-238791397 TGCCTTTGACCAGCTGGGCACGG - Intergenic
948565628 2:238884461-238884483 TGGCATGGCCAGGCAGGGGAGGG - Intronic
948678385 2:239612361-239612383 TCCCAGGGCCACGCTGGCCATGG + Intergenic
948838357 2:240637001-240637023 AGTCATGGGCAGGCTGGGCATGG - Intergenic
1169880632 20:10342407-10342429 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
1170458507 20:16554973-16554995 TGCCAAGGGCAAGCCAGGCATGG - Intronic
1170466493 20:16626960-16626982 TCCCATGCCCAGGCTGAGCATGG - Intergenic
1170508935 20:17057382-17057404 AGCCATGGCCCAACTGGCCAGGG + Intergenic
1171498401 20:25574313-25574335 TGCCATGGCATGGCTGGGCAAGG + Intronic
1171784415 20:29449149-29449171 GGCCAGGGCCAGGCTGGGCCAGG + Intergenic
1172178545 20:32986931-32986953 TGCCCCGTCCAAGCTGAGCAAGG + Intronic
1172191582 20:33064881-33064903 TGCCAAGGCACAGCAGGGCAAGG - Intronic
1172469229 20:35178939-35178961 TGCCAAGCGCAAGCTGGGCACGG + Intergenic
1173908968 20:46650101-46650123 TGCCCTGGCTGGGCTGGGCAGGG + Intronic
1176022369 20:62968297-62968319 CGCCATGGCCATGCTGGGCAGGG - Exonic
1176032297 20:63018423-63018445 TGCCCTGGCCGTGCTCGGCAAGG + Intergenic
1176624829 21:9083705-9083727 AGGCAGGGCCGAGCTGGGCAAGG - Intergenic
1178169088 21:30018452-30018474 TGCCAAGGCCAAGATGGACATGG - Intergenic
1178876205 21:36416042-36416064 TGTCATGGGCAAGCTGGGCGCGG - Intronic
1179307289 21:40166451-40166473 TGCCATGGCCCACCAGGTCAGGG + Intronic
1179432112 21:41328893-41328915 TGCCAGGGCCGAGCTGGACGTGG - Intronic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1179910976 21:44448756-44448778 TGCCATTGCTGAGCTGGCCAGGG - Intergenic
1180839903 22:18954423-18954445 GGCCAAGGCAAGGCTGGGCAGGG + Intergenic
1180982399 22:19885004-19885026 TGCAAAGGCCAAGAGGGGCAGGG + Intronic
1181587895 22:23863919-23863941 AAACAAGGCCAAGCTGGGCACGG - Intronic
1182647143 22:31819346-31819368 TGGGATGGCCAAAGTGGGCATGG - Intronic
1183526414 22:38325876-38325898 AGCCAAGACCAAGATGGGCAAGG - Intronic
1183526459 22:38326042-38326064 AGCCAAGGCCTAGCTGGGTAAGG - Intronic
1184238816 22:43200832-43200854 TGCCCTGGGCACACTGGGCATGG + Exonic
1184728698 22:46361107-46361129 TTCCACGGCCACCCTGGGCATGG + Exonic
1185262455 22:49875709-49875731 TGAAATGGACAAGCTGGGCGGGG - Intronic
949684533 3:6553264-6553286 TGCCAGGAACATGCTGGGCAAGG - Intergenic
950119917 3:10474915-10474937 AGCCATGGACATGCTGGGCCAGG - Intronic
950126264 3:10511592-10511614 TACCCTTCCCAAGCTGGGCATGG - Intronic
950163622 3:10777835-10777857 TGCTAAGGCAAAGCTGGGCTGGG + Intergenic
950970222 3:17178921-17178943 AGGCATGGCCATGCTGGTCAGGG + Intronic
951076115 3:18394794-18394816 TGCCATGGGAGAGCTGCGCAGGG + Exonic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
954426029 3:50443606-50443628 GTCCAAGGCCAAGCTGGGCCAGG - Intronic
954582011 3:51707950-51707972 GGCCATGGCTAGGGTGGGCAGGG + Intronic
954684013 3:52360948-52360970 TCCCTGGGCAAAGCTGGGCAGGG + Intronic
954748212 3:52798922-52798944 GGCCCTGGCCGAGCTGAGCAAGG + Intronic
955111758 3:55957633-55957655 TGCCAAGGGCAAGCCAGGCATGG + Intronic
955367644 3:58325380-58325402 GGCTAAGGCCTAGCTGGGCATGG - Intergenic
955696123 3:61638726-61638748 AGGCATGGCAAGGCTGGGCACGG - Intronic
957307893 3:78481273-78481295 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
958270891 3:91497918-91497940 TGCCTTGGGCAAACTGGACATGG - Intergenic
958593497 3:96190523-96190545 TGCCATGGGTGAGCTGGTCATGG - Intergenic
958677960 3:97291963-97291985 TGCCAAGGGCAAGCCAGGCACGG + Intronic
961365614 3:126397697-126397719 TGGCATGGGCAAGGTGGGCAGGG + Intronic
961505468 3:127368299-127368321 TGGCAGGGCCGGGCTGGGCAAGG - Intergenic
961536346 3:127573247-127573269 TTCCAGGGCCATGCTTGGCAAGG - Exonic
961942849 3:130655890-130655912 TGCCAAGGGCAAGCCAGGCATGG + Intronic
962179042 3:133186056-133186078 TGCAAGGCCCCAGCTGGGCACGG - Intronic
962293119 3:134154133-134154155 AGCTATGGGCAATCTGGGCAAGG + Intronic
963290537 3:143482639-143482661 TGCCAGGGCTAAGTTGGGCTTGG + Intronic
963381040 3:144530690-144530712 TGCCATAATCAAGATGGGCAAGG + Intergenic
963905976 3:150773991-150774013 TGCCAAGGGCAAGCTGGACACGG + Intergenic
967497244 3:190155602-190155624 TGCCTTGTCTGAGCTGGGCATGG - Intergenic
968142822 3:196272980-196273002 TGCCAAGGACAAGCCAGGCACGG + Intronic
968444358 4:642179-642201 TGACATCACCCAGCTGGGCATGG + Intronic
968618481 4:1592942-1592964 TGCCATAGGCTAGCCGGGCAGGG - Intergenic
968760690 4:2441700-2441722 AGGCATGGCCCAGCGGGGCATGG - Intronic
969354064 4:6614813-6614835 AGCAATGACCAAGGTGGGCAAGG + Intronic
969509203 4:7608023-7608045 TGCCATGCCCTGGCAGGGCATGG - Intronic
969699679 4:8761328-8761350 GGCCCAGGCCAATCTGGGCATGG - Intergenic
971092541 4:23361665-23361687 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
972766975 4:42160117-42160139 TGGCATGCCCAGGCAGGGCATGG - Intergenic
973653614 4:53022611-53022633 TGCCAAGGCCACGCAGAGCAGGG - Intronic
973769764 4:54195601-54195623 GGCAATGGCTAGGCTGGGCATGG + Intronic
974683371 4:65194129-65194151 TGCCAAGGGCAAGCCAGGCAAGG + Intergenic
975498438 4:75058725-75058747 TGCCAAGGGCGAGCTGGGCATGG - Intergenic
976361956 4:84190186-84190208 TGCAAAGGCCAAGATGGGCAAGG + Intergenic
976637473 4:87301256-87301278 TGCCATTGGCAAGCGGGGTAAGG - Intergenic
977748419 4:100579484-100579506 TGCCATTGCCCACCCGGGCAAGG - Intronic
981076770 4:140600532-140600554 TGCCAGGGCCAAGTAGTGCAAGG - Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
982843685 4:160223711-160223733 GGCCAGGGACAAGATGGGCAGGG + Intergenic
984330095 4:178303449-178303471 AGCCCTTGCCTAGCTGGGCATGG - Intergenic
984701235 4:182819922-182819944 TGCCATGGCCTATCTGGGCCTGG + Intergenic
985756257 5:1720384-1720406 TGCCAAGGCCATTCTGAGCATGG + Intergenic
985969779 5:3365878-3365900 GGCCATGGCCCTTCTGGGCATGG - Intergenic
986331415 5:6718720-6718742 TTCCATGGCCAAGCTCCACAAGG + Intronic
987999710 5:25331908-25331930 TGCCAAGGGCAAGCCAGGCATGG - Intergenic
990490482 5:56298467-56298489 TCACAGGGCCAAGCTGGGAACGG - Intergenic
994025332 5:95074944-95074966 CGACAGAGCCAAGCTGGGCATGG - Intronic
997267278 5:132502202-132502224 TGCCAGGGTCATGCAGGGCAGGG - Intergenic
997417234 5:133738533-133738555 TGCCATGGCCAAGCAGAGTGGGG - Intergenic
997671612 5:135679345-135679367 TGCGAGGGCCGAGCTGGGCCAGG + Intergenic
999988116 5:157023848-157023870 TGACAGTGCAAAGCTGGGCATGG + Intergenic
1002077141 5:176715008-176715030 ACCAATGGCTAAGCTGGGCACGG - Intergenic
1002107796 5:176888743-176888765 TGCCTTGGCTCAGCAGGGCAGGG + Exonic
1002141725 5:177145620-177145642 TTCCATGGCCAGGCTGGGCGTGG + Intronic
1003961201 6:11210967-11210989 TGACATGGCCAGGATGGGGAGGG - Intronic
1003961338 6:11211891-11211913 TGACATGGCCAGGATGGGGAGGG + Intronic
1005760624 6:28964604-28964626 TTACCAGGCCAAGCTGGGCATGG + Intergenic
1005975443 6:30794664-30794686 TGGCACTGCCCAGCTGGGCATGG - Intergenic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1007220191 6:40272757-40272779 AGCCATGGCTAAGGTGGACAAGG + Intergenic
1007462460 6:42028351-42028373 GGCGATGGCCATGCTGGGCGAGG + Intronic
1007779408 6:44244159-44244181 TGTCATGGCCTGGCTAGGCATGG + Intergenic
1008365699 6:50677085-50677107 TGAGACGGCCAGGCTGGGCATGG - Intergenic
1009870735 6:69450028-69450050 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1009882884 6:69591306-69591328 TGCTATTACCAGGCTGGGCACGG - Intergenic
1011275887 6:85631050-85631072 GGCCATGGCTTGGCTGGGCACGG + Intronic
1011603964 6:89083797-89083819 TACCATGAACAAGCTGGCCATGG - Exonic
1013236793 6:108203956-108203978 GGCCTTGGCCAAGCTGCACACGG + Intergenic
1013287166 6:108691454-108691476 GGGCATGGCCAAGCTGAGGAGGG - Intergenic
1013303374 6:108824898-108824920 AGCAAAGGCCATGCTGGGCATGG + Intergenic
1016987542 6:149906301-149906323 TGCCATGGCTGAGCTGCGAAAGG + Intergenic
1018469809 6:164085365-164085387 TGCCATGGCAACGCCGGGCCTGG - Intergenic
1018659848 6:166076111-166076133 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1019179667 6:170178368-170178390 TGCCAGGGCCATGTTGGCCACGG + Intergenic
1019432186 7:1004223-1004245 TGCCATGGCCTGGCTGGCCCGGG - Intronic
1019609404 7:1929384-1929406 TGCCACGTCCAGGCTGGGCCAGG - Intronic
1019723089 7:2585326-2585348 TGCTGTGACCAGGCTGGGCATGG - Intronic
1019737682 7:2658744-2658766 TGGCTGGGCCAAGGTGGGCAGGG + Intronic
1020217263 7:6202747-6202769 AGCAATGGCCTGGCTGGGCACGG - Intronic
1020255035 7:6498150-6498172 GGCCATGGAGGAGCTGGGCAAGG - Exonic
1023939502 7:44760624-44760646 TGACAAGGCCAGGGTGGGCATGG + Intronic
1025235475 7:57232037-57232059 TGCCTTGCTCAGGCTGGGCACGG - Intergenic
1025787538 7:64657449-64657471 TACAATGGCCAAGGTGGCCAGGG - Intergenic
1026999146 7:74639711-74639733 TAGCATGGCCAGGCCGGGCACGG + Intergenic
1027803201 7:82781890-82781912 TGGCATGCCCAGGGTGGGCATGG + Intronic
1028197129 7:87920236-87920258 TGCCATGGCCACTGTGGGGATGG - Intergenic
1028270450 7:88781930-88781952 GGCCTTGGCCAAGATGGGAAAGG + Intronic
1029462010 7:100700235-100700257 TGCTATGGACGGGCTGGGCACGG + Intergenic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1032825878 7:135567339-135567361 TGGGAAGGCCAAGGTGGGCAGGG + Intronic
1033534420 7:142298828-142298850 TGCCAGTGCCAAGCTTGGAAAGG + Intergenic
1033803491 7:144928058-144928080 TGGCATCGACCAGCTGGGCATGG + Intergenic
1034440220 7:151082393-151082415 TGCCATGGCTGCGCTGGGCTGGG + Exonic
1034934044 7:155187208-155187230 GACCAAGGCCAAGCTGGGCCAGG + Intergenic
1035209721 7:157318848-157318870 TCCCATGTCCCGGCTGGGCACGG + Intergenic
1035813520 8:2513558-2513580 CACCACGGACAAGCTGGGCAGGG + Intergenic
1035897948 8:3425297-3425319 TGCCCTGTCCCAGCTGGGCAAGG + Intronic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1037162513 8:15790471-15790493 TGCCATGGTGAGGCCGGGCATGG - Intergenic
1037472610 8:19225275-19225297 AGCCTTGCCCAAGCTGGGCTAGG - Intergenic
1037924814 8:22835794-22835816 TGCCATGCGCAAGCAGGACAGGG - Intronic
1038210699 8:25516910-25516932 GGCCACGGCCATGCTGGGAAAGG + Intergenic
1038356840 8:26837358-26837380 TACAATAGCCAGGCTGGGCATGG + Intronic
1039546291 8:38413645-38413667 CGCCATTGGCAAGCTGGGCTGGG + Exonic
1040959189 8:53013019-53013041 TGACATGGCCAGGGTGAGCAAGG + Intergenic
1041956069 8:63559081-63559103 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1042612172 8:70610992-70611014 TGTAATGTCCAAGCTGGCCATGG - Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045414718 8:101954320-101954342 TGGCATGACCCATCTGGGCAAGG - Intronic
1045580244 8:103470710-103470732 TGCCATGCCCAAGGTCTGCAGGG + Intergenic
1047524075 8:125617576-125617598 TTCCATGACCAAGCTGGACATGG - Intergenic
1048469922 8:134696632-134696654 TGCCCTGTCCCACCTGGGCAGGG - Intronic
1048814665 8:138321201-138321223 TGCCATGCCCATGCTTGCCATGG - Intronic
1049117532 8:140702508-140702530 AAGCATGGCAAAGCTGGGCATGG - Intronic
1049472112 8:142781087-142781109 TGCCATGGACAAGCCGGACTGGG - Intergenic
1049744227 8:144256402-144256424 TGTCCTGGCCAAGGGGGGCAGGG - Intronic
1049970090 9:814475-814497 TCCTAGGGCCATGCTGGGCATGG + Intergenic
1050276696 9:4008281-4008303 TGTCATGGCCAAGCGGTTCAGGG - Intronic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1051372565 9:16370983-16371005 TGACATGGCCATCCTCGGCAGGG + Intergenic
1052182502 9:25546829-25546851 TACCATGCACAGGCTGGGCACGG - Intergenic
1052764837 9:32630445-32630467 TGCCAGGGCCAAGGTAGGCTGGG - Exonic
1053130338 9:35610959-35610981 TGGGAAGGCCAGGCTGGGCACGG + Intronic
1054463981 9:65481688-65481710 TGCCAGGGCTATGCTGAGCAGGG + Intergenic
1055318059 9:75053949-75053971 TGCCATGGAAAAGCTGCTCATGG + Intergenic
1056539655 9:87560284-87560306 TTCCAAGGGCAGGCTGGGCATGG - Intronic
1056792217 9:89633288-89633310 AGGCATGGCCAAGTTGGGCCAGG - Intergenic
1056996028 9:91460246-91460268 TGCCATGGGCAAGGAGGGCTTGG + Intergenic
1057189162 9:93076820-93076842 TGGCATGGCTCTGCTGGGCATGG + Intronic
1057214683 9:93221149-93221171 TGCCGTGCTCATGCTGGGCATGG + Intronic
1060547184 9:124468430-124468452 TGGCAAGGCCGGGCTGGGCATGG + Intronic
1061225885 9:129280824-129280846 TGCCCTGGCCCAGCTGGACCTGG + Intergenic
1062450579 9:136614139-136614161 GGCCTTGGCAAGGCTGGGCAAGG + Intergenic
1062604636 9:137341023-137341045 ACTCAAGGCCAAGCTGGGCAGGG + Intronic
1062682055 9:137787487-137787509 GGCCGTGGCCGAGCTGGGCACGG - Intronic
1203747992 Un_GL000218v1:54133-54155 AGGCAGGGCCGAGCTGGGCAAGG - Intergenic
1187263983 X:17714020-17714042 TGTCAGGGACAAGATGGGCATGG + Intronic
1187380728 X:18799248-18799270 TGACATGGTCTAGCTGGGCGTGG + Intronic
1187401358 X:18963237-18963259 AGGCCTGGCCAATCTGGGCACGG + Intronic
1187665723 X:21607511-21607533 TTCCATGGTCAGGCCGGGCATGG + Intronic
1189319485 X:40079109-40079131 TGCCATGGCCGGTCTGGACAAGG - Intronic
1189851227 X:45178128-45178150 GGCCAGGACCCAGCTGGGCATGG - Intronic
1190360443 X:49644189-49644211 TGCCAAGGGCAAGCCAGGCATGG + Intergenic
1190708485 X:53049137-53049159 TGCCACTGCCAAGCTGGGAGGGG - Exonic
1191136134 X:57067367-57067389 TGCCATGGAGAAGTTGGGCTGGG - Intergenic
1193112436 X:77743290-77743312 TGCCATGGGGAAGTTGGGCCTGG - Intronic
1193231646 X:79053813-79053835 TGCCAATGACAAGATGGGCATGG - Intergenic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1198118308 X:133566105-133566127 TTCCATGGCCAATCTGTTCATGG - Intronic
1198491679 X:137147430-137147452 GGCCATGGGCAGGCTGGGAAAGG + Intergenic
1199807309 X:151313111-151313133 AGCCATGTCTTAGCTGGGCATGG + Intergenic
1201161340 Y:11169127-11169149 AGGCAGGGCCGAGCTGGGCAAGG - Intergenic