ID: 1036687832

View in Genome Browser
Species Human (GRCh38)
Location 8:10923664-10923686
Sequence CACGGACCTCCTCACCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036687832_1036687836 -4 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687836 8:10923683-10923705 CGTGTGGGTGTCCATGAACGTGG No data
1036687832_1036687843 18 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687843 8:10923705-10923727 GTGACACGGAGGGCCTCCTGGGG No data
1036687832_1036687842 17 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687842 8:10923704-10923726 GGTGACACGGAGGGCCTCCTGGG No data
1036687832_1036687841 16 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687841 8:10923703-10923725 TGGTGACACGGAGGGCCTCCTGG No data
1036687832_1036687837 4 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687837 8:10923691-10923713 TGTCCATGAACGTGGTGACACGG No data
1036687832_1036687840 8 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687840 8:10923695-10923717 CATGAACGTGGTGACACGGAGGG No data
1036687832_1036687844 28 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG No data
1036687832_1036687839 7 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687839 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036687832 Original CRISPR CACGGACCTCCTCACCAATG TGG (reversed) Intronic
900776129 1:4586768-4586790 CAGGGGCCACCTCACCACTGAGG - Intergenic
903259009 1:22121222-22121244 CATGAACCTCCACAACAATGAGG - Exonic
907207439 1:52785841-52785863 CAATGATCTACTCACCAATGTGG - Intronic
916746035 1:167685495-167685517 CACTTACCTCCTCACCATTCTGG - Exonic
920977061 1:210796248-210796270 CATGGACCTCATCAGCCATGAGG + Intronic
1063934639 10:11065159-11065181 CACTGACCACCTCTCCAAAGAGG - Intronic
1064496089 10:15911952-15911974 CAAGCCCCTCCTCCCCAATGTGG + Intergenic
1069308650 10:67005286-67005308 TACCAACCTCCTCATCAATGTGG + Intronic
1069552475 10:69374263-69374285 CAAGGACCTGCACACCAAAGAGG - Intronic
1077415554 11:2422812-2422834 CAGGGTCCTCCTCACCCCTGGGG - Intronic
1081851576 11:46278192-46278214 GTCGGACTTCCTCAACAATGCGG + Exonic
1081989255 11:47328882-47328904 CACGGATCCCCTCTCCCATGGGG + Intronic
1084438496 11:69157557-69157579 CACGGGCCTCTTGACCAAGGAGG + Intergenic
1092672701 12:10882275-10882297 CAGGGACCACCTCCCCAAGGGGG - Exonic
1092676993 12:10931000-10931022 CAGGGACCACCTCCCCAAGGGGG + Exonic
1107513583 13:41107888-41107910 CATGCACCTCCTCCCCACTGAGG + Intergenic
1111687347 13:91517754-91517776 CTGGGACCTCCCCACCCATGGGG - Intronic
1120799897 14:88676280-88676302 CTGGGACTTCCTCAGCAATGTGG - Intronic
1122525151 14:102376835-102376857 CACGGCCCTCGACACCAACGGGG + Exonic
1125726381 15:41870323-41870345 CACGAGCCTCCCCAACAATGTGG - Exonic
1130093283 15:80838617-80838639 CAAGGACCTCCTGACTAGTGAGG - Intronic
1130307810 15:82726543-82726565 CAAGGACCTGTACACCAATGTGG - Intergenic
1136147178 16:28322393-28322415 CAGGGACAGCCTCACCCATGTGG - Exonic
1138341943 16:56295731-56295753 TACGGTGCTCCTCACCAAGGTGG + Intronic
1144658317 17:17052130-17052152 CACTGAGCTGCTCAGCAATGGGG + Intronic
1147559735 17:41501448-41501470 CACGCACCACCTGACTAATGAGG - Intronic
1149895527 17:60425922-60425944 CTCAGGCCTCCTGACCAATGGGG - Intronic
1152745348 17:82036264-82036286 CATGGACGTCATCACCACTGTGG + Exonic
1152781333 17:82228620-82228642 CGCGCACCTCCCCACCAAAGGGG + Intronic
1154270043 18:12911297-12911319 CATCGACCTCCGCACCAATCAGG + Intronic
1155903435 18:31419628-31419650 CACGGACCTGCTCACCTCAGTGG - Intergenic
1158147908 18:54336452-54336474 CTGAGACCTCCCCACCAATGCGG + Intronic
1165258022 19:34591794-34591816 CTGGGACCACCTGACCAATGTGG + Intergenic
1167112763 19:47471758-47471780 CCCCCACCTCCCCACCAATGGGG + Intronic
925940226 2:8809985-8810007 CACCCATCTCCTCACCACTGAGG + Intronic
927015944 2:18961819-18961841 CACAGATCTCCTAACCAATTTGG - Intergenic
927077050 2:19589094-19589116 CAAGAACCTCCACACCAACGAGG + Intergenic
932211943 2:69938773-69938795 CATGGACCTCACCACCAGTGAGG + Exonic
932449248 2:71799094-71799116 CACAGCCCTCATCACCACTGGGG - Intergenic
934880976 2:97978583-97978605 CAAGGACCTCCTGAGCACTGTGG - Intronic
942325758 2:174775942-174775964 CAGGGACCTCCTGGCCAGTGCGG - Intergenic
943033763 2:182716039-182716061 CCCGCGCCCCCTCACCAATGCGG - Intronic
1170843064 20:19939655-19939677 CACTGACTTCCTTGCCAATGTGG + Intronic
1170976007 20:21165384-21165406 AAAGGCCCTCCTCACCCATGGGG - Intronic
1171306213 20:24108821-24108843 CAAGGAACTCCTCACCCATAGGG - Intergenic
1173228559 20:41176490-41176512 CAAGGACGTCCTAACCAACGTGG - Intronic
1180844128 22:18972281-18972303 CACGGAACCCCTCACCAAGAAGG - Intergenic
1183355397 22:37356170-37356192 CTAGGACCTCCTGAGCAATGTGG + Intergenic
954196269 3:48998945-48998967 CTGGAACCTCCTCTCCAATGAGG - Intronic
955449183 3:59049549-59049571 CACGGACTACCTCACCCAAGAGG + Intronic
962996772 3:140636626-140636648 CAAGGACCTCCTCACTAGCGTGG + Intergenic
963907310 3:150783280-150783302 CTCTGACCTTCTCAGCAATGGGG - Intergenic
964554566 3:157922117-157922139 CACTGACCTCCATTCCAATGTGG + Intergenic
967204080 3:187103526-187103548 CAGGGAGCTCCTTACCAGTGGGG - Intergenic
968728371 4:2258666-2258688 CACAGCCCACCTTACCAATGGGG + Intronic
972048393 4:34697224-34697246 CAAGACCTTCCTCACCAATGTGG - Intergenic
974390415 4:61259656-61259678 AAATGTCCTCCTCACCAATGAGG + Intronic
990701176 5:58476372-58476394 CTGGGACCTCCTCAGCCATGTGG - Intergenic
991210401 5:64097919-64097941 CCCTAACCTCTTCACCAATGTGG + Intergenic
994460779 5:100066055-100066077 CACGGACCACATCACCATGGCGG + Intergenic
998130196 5:139648018-139648040 CCCAGACCGCCTCACCAAAGCGG + Intronic
998176453 5:139904681-139904703 CACAGACCTCCTCGCCGAAGAGG + Intronic
1019384198 7:745120-745142 CTGGGCTCTCCTCACCAATGAGG + Intronic
1023168418 7:37366007-37366029 CAGGGACCTCTCCACCAAGGAGG + Intronic
1023251505 7:38267067-38267089 CACAGACCTTCTCATTAATGGGG - Intergenic
1031826667 7:126574283-126574305 CATTGAACTCCTCATCAATGTGG + Intronic
1036687832 8:10923664-10923686 CACGGACCTCCTCACCAATGTGG - Intronic
1038641309 8:29331320-29331342 GCTGGACCTCCTCCCCAATGGGG + Intergenic
1045474749 8:102543297-102543319 CTGGGACCTGCTCTCCAATGAGG - Intergenic
1057115478 9:92517066-92517088 CATGGACCCCTTCTCCAATGAGG - Intronic
1058982906 9:110186707-110186729 CATGGACCACCTCGCCAAGGAGG + Intergenic
1059465886 9:114468665-114468687 CAGGGCCCTCCTTACTAATGTGG - Intronic
1059838474 9:118184459-118184481 CACTGAGCTGCTCACCAATTAGG + Intergenic
1060532268 9:124354868-124354890 CAAGAGCCTCCTCACCACTGTGG + Intronic
1194603361 X:95950853-95950875 CAGGGACCTGCTCACCACTGTGG + Intergenic
1201611981 Y:15852819-15852841 GTCGCAACTCCTCACCAATGAGG + Intergenic