ID: 1036687835

View in Genome Browser
Species Human (GRCh38)
Location 8:10923682-10923704
Sequence CACGTTCATGGACACCCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036687835_1036687848 19 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687848 8:10923724-10923746 GGGGCACCAAGAGGACCTGCGGG No data
1036687835_1036687852 28 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687852 8:10923733-10923755 AGAGGACCTGCGGGGTCTGGAGG No data
1036687835_1036687849 20 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687849 8:10923725-10923747 GGGCACCAAGAGGACCTGCGGGG No data
1036687835_1036687851 25 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687851 8:10923730-10923752 CCAAGAGGACCTGCGGGGTCTGG No data
1036687835_1036687844 10 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG No data
1036687835_1036687842 -1 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687842 8:10923704-10923726 GGTGACACGGAGGGCCTCCTGGG No data
1036687835_1036687847 18 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687847 8:10923723-10923745 TGGGGCACCAAGAGGACCTGCGG No data
1036687835_1036687841 -2 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687841 8:10923703-10923725 TGGTGACACGGAGGGCCTCCTGG No data
1036687835_1036687840 -10 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687840 8:10923695-10923717 CATGAACGTGGTGACACGGAGGG No data
1036687835_1036687843 0 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687843 8:10923705-10923727 GTGACACGGAGGGCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036687835 Original CRISPR CACGTTCATGGACACCCACA CGG (reversed) Intronic
900433225 1:2612590-2612612 CACGCTCCTGGAGTCCCACAGGG + Intronic
900566920 1:3337879-3337901 CACATGCACGGACACACACATGG + Intronic
900689366 1:3970912-3970934 CCCATTCATGGAAACCCATAGGG - Intergenic
901220743 1:7582381-7582403 CTCGTTCATGGACACACCCAAGG - Intronic
907839855 1:58146335-58146357 CACATACATGCACACACACACGG - Intronic
910194719 1:84628806-84628828 CATGTTCATGGACACCATGAGGG - Exonic
912672483 1:111643652-111643674 CAGTTTCATGTACATCCACAAGG - Intronic
915715942 1:157945163-157945185 CACCTGAATGGACACCCAAAGGG + Intergenic
916275880 1:162992594-162992616 CACGTGCAAGGACTCTCACATGG - Intergenic
918341147 1:183568830-183568852 CACGTGCACAGCCACCCACATGG - Intronic
919293033 1:195658249-195658271 CACATGCATAGACACACACACGG - Intergenic
1072326256 10:94301584-94301606 TAAGTCCATGGACACCCACTTGG - Intronic
1075404722 10:122187183-122187205 CACATGTATGCACACCCACATGG + Intronic
1075428158 10:122358045-122358067 GACCTTCATTGACACCCAGAGGG - Intergenic
1076655220 10:132019384-132019406 CACGTGCATGCACACCCAACCGG + Intergenic
1077304916 11:1864713-1864735 CACAGTCAGGGAGACCCACAGGG + Intronic
1077871418 11:6265373-6265395 CAAGTTCAAGGGCACACACATGG + Intronic
1078065927 11:8079646-8079668 CACATGCATGCACACACACATGG - Intronic
1081311943 11:41585016-41585038 CAAATTCAAGGACACCCAAAAGG - Intergenic
1082276557 11:50228506-50228528 CAGATTCATAGATACCCACATGG - Intergenic
1084249814 11:67888781-67888803 AATTTTTATGGACACCCACACGG + Intergenic
1088264679 11:107977894-107977916 CACCCTCATGGACACACCCAGGG - Intergenic
1088721107 11:112592446-112592468 CCCATTGATTGACACCCACAGGG - Intergenic
1090481053 11:127068648-127068670 CACGTACATGGACATATACAGGG + Intergenic
1093338534 12:17940834-17940856 CACCTTCATACACACACACACGG - Intergenic
1094362507 12:29644995-29645017 CACATTCATGGACAGTTACAGGG - Intronic
1099929220 12:89053951-89053973 CACAATCATGGTGACCCACAAGG + Intergenic
1102443634 12:112983709-112983731 CACGCTCCTGGACAACCACTGGG - Intronic
1103117950 12:118353635-118353657 CTCGTTCCTGGACTACCACAGGG - Intronic
1104175455 12:126327298-126327320 CACATACATAGACACACACACGG - Intergenic
1105432369 13:20348920-20348942 CTCATTCATGCACACACACACGG + Intergenic
1106891987 13:34255555-34255577 CTTGGTCATGGACACCCCCAAGG - Intergenic
1120723778 14:87916124-87916146 CACGCTCATGGACTGCAACAGGG + Intronic
1129171953 15:73813315-73813337 CACGCACAGGGACACACACAAGG - Intergenic
1132764706 16:1528446-1528468 CACATGCATGCACACACACATGG + Intronic
1132798384 16:1738172-1738194 CACGCTCACGGACGCTCACACGG - Intronic
1132885924 16:2181897-2181919 GCCGATCATGGACAGCCACACGG + Exonic
1133664870 16:7956820-7956842 CACATGCATGCACACACACACGG - Intergenic
1136619081 16:31416082-31416104 CACTTTGCTGGACACCAACAAGG - Intronic
1138554745 16:57764811-57764833 CACCCCCATGGCCACCCACATGG - Intronic
1139637463 16:68266394-68266416 CAGGTTCCATGACACCCACAGGG - Intronic
1140868005 16:79080997-79081019 CACGCACATGCACACCCACCAGG + Intronic
1148872647 17:50667876-50667898 CACGTACACGTACACCCAGAGGG - Exonic
1151999150 17:77634401-77634423 CACTTTCAAAGACTCCCACATGG - Intergenic
1162907923 19:13834334-13834356 CACGATCCAGGACACCCCCAAGG + Intergenic
1167720589 19:51177495-51177517 GACGTGGATGCACACCCACAGGG - Intergenic
925602066 2:5618167-5618189 AAAGTTCATGGATTCCCACAGGG + Intergenic
926140984 2:10368056-10368078 CATGTGTATGGACACACACATGG - Intronic
928361016 2:30662458-30662480 TGCGTTCCTGAACACCCACATGG - Intergenic
939180641 2:138798431-138798453 CAAGTTCTTAGAGACCCACAAGG + Intergenic
943386915 2:187212529-187212551 CACGTGCAATGACACCCATAGGG + Intergenic
944203334 2:197131826-197131848 CACGTTTATGGAAGCCCACTTGG - Intronic
947969124 2:234307104-234307126 CACGATCAAGGCCACCCCCAAGG - Intergenic
948226942 2:236318717-236318739 CACATGCATGCACACACACAGGG - Intergenic
1170552968 20:17492955-17492977 CAAGATCATGCACACTCACATGG + Intergenic
1170881926 20:20304526-20304548 CACACTCATGCACACTCACACGG + Intronic
1176040280 20:63061724-63061746 CACGGACATGGACACAGACACGG - Intergenic
1176040303 20:63061884-63061906 CACGGACATGGACACAGACACGG - Intergenic
1178433042 21:32533129-32533151 CACATGCATGCACACACACATGG - Intergenic
1178816850 21:35938535-35938557 CACCTTCATGGAAACACCCAGGG - Intronic
1182146250 22:27998583-27998605 CACCTTCATGGCCTCCCCCAGGG + Exonic
1182678986 22:32063583-32063605 GACTTTCCTGGACACCCAAAAGG - Intronic
1183092393 22:35531592-35531614 CAACTTCATGGACACACACTTGG + Intergenic
951221374 3:20072042-20072064 CCACTTCATGGACACCCACTGGG + Intronic
954977973 3:54714818-54714840 CATGTTGATGGACACTCAGATGG - Intronic
968868966 4:3231600-3231622 CAGGCTGAAGGACACCCACAAGG - Intronic
969161136 4:5260096-5260118 CACGTGCACGCACACACACACGG + Intronic
971968301 4:33591567-33591589 CAAGGACATGGACACACACAAGG - Intergenic
974325643 4:60411620-60411642 TGCGTGCATGCACACCCACATGG + Intergenic
976868019 4:89754452-89754474 CATGTTCAGGAATACCCACAAGG - Intronic
977258120 4:94762726-94762748 CATTTTCATAGCCACCCACATGG - Intronic
985573971 5:665230-665252 CAAGTTCACGGGCTCCCACAAGG - Exonic
985844263 5:2332583-2332605 CAGGTACATGCACACACACACGG - Intergenic
988836719 5:35040029-35040051 CACGTGCATGCACACACACACGG - Intronic
988860802 5:35276048-35276070 CACGTTTGTGGACATCCACTGGG + Intergenic
992460387 5:76954334-76954356 CGCGTTCGAGGACCCCCACACGG + Intronic
994611881 5:102052340-102052362 CACGTGCACAGACACACACATGG - Intergenic
1000003789 5:157164690-157164712 CACGTGCATACACACACACAGGG + Intronic
1007588477 6:43007224-43007246 CACCTTCATCGAATCCCACAGGG + Exonic
1007739038 6:44000097-44000119 GCCCTTCATGAACACCCACATGG - Intergenic
1015293245 6:131561717-131561739 CACCTTCATGGCCACCTGCATGG - Intergenic
1018841568 6:167521303-167521325 CACTTTCATGCAGACCCACAGGG + Intergenic
1019568597 7:1697255-1697277 CCCATCCATGGACACGCACAGGG + Intronic
1026192208 7:68139626-68139648 CAGATTCATAGATACCCACATGG - Intergenic
1032160945 7:129509946-129509968 AACGTTCAAGGACACCTGCAAGG - Intronic
1036687835 8:10923682-10923704 CACGTTCATGGACACCCACACGG - Intronic
1036845669 8:12168379-12168401 AACGTTCATGGATGACCACATGG - Intergenic
1036867037 8:12410698-12410720 AACGTTCATGGATGACCACATGG - Intergenic
1039791064 8:40875841-40875863 CACAATCGTGGACACCTACAAGG - Intronic
1041171146 8:55142937-55142959 CATGCTCATGGTCACCCACAAGG - Intronic
1043382977 8:79722742-79722764 CAGGTTTAAGGACATCCACAAGG + Intergenic
1046862893 8:119114542-119114564 CTCATTCATGCACAACCACAAGG - Intergenic
1047471923 8:125183102-125183124 CACCTTCATTTACACACACATGG + Intronic
1052086751 9:24276492-24276514 TACATTCATGAACAACCACAAGG + Intergenic
1060762346 9:126266523-126266545 CACATGCATGCACACACACAGGG + Intergenic
1062200757 9:135301508-135301530 CACCTTCTTGGGCTCCCACATGG + Intergenic
1186618252 X:11212602-11212624 AACGTTCATGCAGACACACATGG - Intronic
1186657876 X:11634952-11634974 CACATTCAAGCTCACCCACATGG + Intronic
1186902859 X:14076580-14076602 CACATGCATGCACACACACAGGG + Intergenic
1196712349 X:118775999-118776021 CACATCCATGGACACTCACTGGG + Intronic
1197601866 X:128540916-128540938 CAAGTTCATAGAGACCTACAAGG - Intergenic