ID: 1036687838

View in Genome Browser
Species Human (GRCh38)
Location 8:10923694-10923716
Sequence CCTCCGTGTCACCACGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036687838_1036687848 7 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687848 8:10923724-10923746 GGGGCACCAAGAGGACCTGCGGG No data
1036687838_1036687847 6 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687847 8:10923723-10923745 TGGGGCACCAAGAGGACCTGCGG No data
1036687838_1036687851 13 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687851 8:10923730-10923752 CCAAGAGGACCTGCGGGGTCTGG No data
1036687838_1036687852 16 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687852 8:10923733-10923755 AGAGGACCTGCGGGGTCTGGAGG No data
1036687838_1036687844 -2 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG No data
1036687838_1036687849 8 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687849 8:10923725-10923747 GGGCACCAAGAGGACCTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036687838 Original CRISPR CCTCCGTGTCACCACGTTCA TGG (reversed) Intronic
900317700 1:2067622-2067644 CCCCCGTGCCACCACCCTCATGG - Intronic
901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG + Intergenic
903943264 1:26946115-26946137 CTTCCGTTTCTCCAGGTTCATGG + Exonic
904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG + Intergenic
905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG + Intergenic
906206730 1:43991205-43991227 ACTCAGGGTAACCACGTTCAGGG - Intergenic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG + Intronic
915298573 1:154939089-154939111 CCTCGGTGACATCACGGTCATGG + Intergenic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
923027899 1:230220565-230220587 CCTCACTGTCACCACGTGCTGGG + Intronic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1063004262 10:1953024-1953046 CCTCCGCATCGCCACGTCCAAGG - Intergenic
1065581505 10:27176159-27176181 CCTCAGTTTCATCACCTTCATGG + Intronic
1083152092 11:60798272-60798294 CCTCAGTTTCCCCACATTCATGG + Intronic
1085391676 11:76185358-76185380 CTTCCGTGTCACCTCCCTCATGG - Intergenic
1089094833 11:115911098-115911120 CCTCCGTGTCCCAAAGTTCTGGG + Intergenic
1089479732 11:118794354-118794376 CCTCCGCCTCCCCAGGTTCAAGG - Intergenic
1091761863 12:3092910-3092932 CCTCCCTGCCACCACGCCCAGGG + Intronic
1093094594 12:14958234-14958256 CCTCCATGTCACCAGGGACAGGG - Intronic
1098905615 12:76159019-76159041 CCTCATTGTCTCCACTTTCATGG + Intergenic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1117791067 14:59342851-59342873 CCTCCTTGACACCACCTTCCCGG - Intronic
1121137806 14:91514013-91514035 CCTCTGTCTCCCCAGGTTCAAGG + Intergenic
1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG + Intergenic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1128346892 15:66859735-66859757 CCTCAGGGTCACCCTGTTCATGG - Intergenic
1128986775 15:72227944-72227966 CATCAGTGTCACAACATTCAAGG + Intronic
1132497409 16:270451-270473 CCTCCATGTCCCCACCCTCAAGG - Intronic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1139661355 16:68423169-68423191 CCTCCTTGTCACCTCCTTTATGG + Intronic
1141300659 16:82812588-82812610 CCTCCGTGTCACTAGATGCAGGG - Intronic
1141957584 16:87383225-87383247 CCGCGGTGACACCACGTTGAGGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG + Exonic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1151929011 17:77219120-77219142 CCTCCGTGTCCCCAGGCTCCAGG - Intergenic
1153730888 18:8010648-8010670 CCTCCATCTCACCAAGTCCATGG - Intronic
1157276480 18:46314331-46314353 CCTCAGTGTTACCTCGATCAAGG - Intergenic
1159851890 18:73534790-73534812 CCTCAGTGTCACCAAGTCCAGGG - Intergenic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG + Intergenic
929998772 2:46847080-46847102 CCTACGTGACACCCTGTTCACGG + Intronic
1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG + Intronic
1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG + Intronic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1176055524 20:63144476-63144498 CCTCCGTGTCACGAAGGGCATGG - Intergenic
1183307988 22:37093271-37093293 CCTCTGTGTCCCCATGTTCCTGG - Intronic
1183457999 22:37933148-37933170 CCTCCGTGTCACCAGGCCCCAGG - Intronic
1184334479 22:43845206-43845228 CCGGGCTGTCACCACGTTCAGGG - Intronic
1184747381 22:46464292-46464314 CCTGCGTGTCACCATCATCACGG - Exonic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
983643759 4:169969129-169969151 GCTCTGAGTCACCACGTACAAGG + Intergenic
994117985 5:96082240-96082262 CCTCTGTGTCAGCACTTGCAAGG - Intergenic
1000202811 5:159028287-159028309 CTTCCTTGTCACCAAGTTCCTGG - Intronic
1003644972 6:7907424-7907446 CCTCACTGTCACCAGGTTCAGGG + Intronic
1006781037 6:36632483-36632505 CCAGCGTGTAATCACGTTCAGGG - Intergenic
1019488527 7:1300486-1300508 CCTCGGTGTCTCCACACTCAGGG - Intergenic
1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG + Intergenic
1025656200 7:63521614-63521636 CCTCCGTGTCCCAAAGTTCTGGG + Intergenic
1035096473 7:156360121-156360143 CCTCTGTGTCCCCAGGTGCAGGG - Intergenic
1035730924 8:1853154-1853176 CCTCCGTGTCATGGCCTTCATGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1043823473 8:84896686-84896708 TCTCCTTGTCCCCACATTCAGGG - Intronic
1188369946 X:29357713-29357735 CCTCCGTGTCATAAGGTTCTTGG + Intronic
1189890542 X:45597555-45597577 CTTCAGTGTTACCACCTTCAGGG - Intergenic
1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG + Exonic