ID: 1036687844

View in Genome Browser
Species Human (GRCh38)
Location 8:10923715-10923737
Sequence GGGCCTCCTGGGGCACCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036687835_1036687844 10 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG No data
1036687838_1036687844 -2 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG No data
1036687832_1036687844 28 Left 1036687832 8:10923664-10923686 CCACATTGGTGAGGAGGTCCGTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036687844 Original CRISPR GGGCCTCCTGGGGCACCAAG AGG Intronic
No off target data available for this crispr