ID: 1036687852

View in Genome Browser
Species Human (GRCh38)
Location 8:10923733-10923755
Sequence AGAGGACCTGCGGGGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036687835_1036687852 28 Left 1036687835 8:10923682-10923704 CCGTGTGGGTGTCCATGAACGTG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1036687852 8:10923733-10923755 AGAGGACCTGCGGGGTCTGGAGG No data
1036687845_1036687852 -8 Left 1036687845 8:10923718-10923740 CCTCCTGGGGCACCAAGAGGACC 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1036687852 8:10923733-10923755 AGAGGACCTGCGGGGTCTGGAGG No data
1036687838_1036687852 16 Left 1036687838 8:10923694-10923716 CCATGAACGTGGTGACACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1036687852 8:10923733-10923755 AGAGGACCTGCGGGGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036687852 Original CRISPR AGAGGACCTGCGGGGTCTGG AGG Intronic
No off target data available for this crispr