ID: 1036688168

View in Genome Browser
Species Human (GRCh38)
Location 8:10925234-10925256
Sequence CTGTTGTTCTGGAGGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036688161_1036688168 10 Left 1036688161 8:10925201-10925223 CCGGGGGGAAACAATCCAGCAAG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG No data
1036688160_1036688168 11 Left 1036688160 8:10925200-10925222 CCCGGGGGGAAACAATCCAGCAA 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG No data
1036688163_1036688168 -5 Left 1036688163 8:10925216-10925238 CCAGCAAGGTTATCACCTCTGTT 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG No data
1036688159_1036688168 12 Left 1036688159 8:10925199-10925221 CCCCGGGGGGAAACAATCCAGCA 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036688168 Original CRISPR CTGTTGTTCTGGAGGAGGAA AGG Intronic
No off target data available for this crispr